Description :
From Genome Similarity Track
Location :
Scaffold_1259:869- 2245
Transcript NameFunction/comments
Phyke_g11720hypothetical protein

Sequence
1376 bases(100 bases per row)
TAAAGCTGTCGTTGGTGGCGGGTGATCAAGTCGTTCAGTGATCCGGCAGTATGGAGCGTGTGTAGGTGCCTGAGGACGGCGCTGAACCCACGTGAACTGA
TATTGTGTTTTTCTTTGAGGAAGGTTAACAACTTGGTCTCGGCTTGTTTACCCAGGTCGAGCACTTTGTCGCGGTAGTCGAGTGCAGCAGGATCCAACAC
GAAGCCatccatcaagaagagcttcatgaaagcgacaagcagcttggccttcgactgctggtgcttcgGCTCCTGTGACTGCCATCGCAGCTTCTGCGCG
TACCGCGCAAACCACGTAGCGTGAAGGTGAGTGACGGACACCCTGCGTTGTTTCTTATTCGGCTGGCTCACATCTTGTTGTCCATCCTGATTGCTTCGCT
TGCTCGTAGTTTGTACCGGATCATTGTTTAGCTTGGTCTCCAGCGCATCTATGCGAACATATTGCCTCTTGACATGCTCGATAAAGCGTTTAATCACAGC
CGCTTGCTCGTCGATGATCTTCTATTTCTGGCTTGGTTCTCTTGATTTAGTTTCTTGGTTGCTTGTCTGTTAGCTTGATGCTTTCGCAGGAAGCTGAGAC
GTGTGTGAGGTGCGACGGCCATGCAAGCAGACCCGCCAAGGTGCATCCAGCAAGGACTACACAGTCCTTGATGCACTTGACGACAGGCCTTTAGGATTTA
AGACCTTCAGCACGGGGAAGTGACGGAAGACACGCGCTGTCAAGGCATCCAGCACGCGCTTgttcacgttgaagctgttggccTCAAAGTTGTGGCATGC
CCCAAACAGAGCGCGCTGAACTCCGATGATCGTGTCAAGCGTCTGTACATCGAAGCTCCGGGGATCTTAAAGTGGCATGTTACTGCTGGGTTTGTACCTT
GGCAATCTTGTGATCCTCCCTGCTAGTGCTGAAGATGTAATTAAATCCCTTGTTTGCCGTGCTCATATTCCAGTAACCACGGTCGAAAACCCACCGCGCT
GTCATCTGATCGCAGCCGTTCGCGTGCTGAGCTCAACCTCGCCGGAAAGAATGAGACGTTAGCGTAGTCTTCACACCTGCAGCCGGAGCTACACGGTCCA
ACACCCAGTTCACATGCGCGTAGATTGTCGGTGCTGTGTCGACACGGGATGTGGCAGCTAGGGTAGCAAGATCAGCGGCGACTAGGGTGGCGTTcaagag
ctccaccaacgGCACATCAGGCGACAGAGTGACAGCCATTTGAGCGACCTGCTCCGGGAGGTTGACGATCAGTGCCGTGCTTGGGGAGGCTTAGTTGATC
AAAGCAAGCGGGGTGGCGAGCAAGGGGCAGGTGGTGAAGTCTGTGTCAGGGATGGGTGACAGCCCTTGCTCTTCCG