Description :
From Genome Similarity Track
Location :
Scaffold_27:869- 14287
Transcript NameFunction/comments
Sapdi_VS20SDRG_08681hypothetical protein
Sapdi_VS20SDRG_08682hypothetical protein
Sapdi_VS20SDRG_08683hypothetical protein
Sapdi_VS20SDRG_08684hypothetical protein
Sapdi_VS20SDRG_08685hypothetical protein

Sequence
13418 bases(100 bases per row)
TTTGGCCTCCTCGAGCTCGTGTAAGTCGTCCTCGTCGTCCTCGAGCACGTCGTTGACGCCCGCGACGATCTTGTTTTTGTACTTTGTCGTAGTTTCGGCG
AGCTTGGCCACCGCACTCGAGTCGACGACAGCGTCCTTGACCCGAAGCGCCATCTTCTCGACCGCGTTCAGATTCTTGGGCTCACGCCACACGGCGGGCC
AGATCTGGTCGACACCGACCGCATAATTGGTTTGAAGCGACATTTGGAACGGGCCCTCCATTCCCGCCTTGTAGGCGGCCACGAGCACAGTGTACGTACG
TGCCGCTAGGTTGCAACGCAAAACGAGTTGGCGCTCACGGACGGGCTGGCCGCTGTGCTCGATGACAACGTCGCGCGTCAGTTCTTTGACACGGCTGGCG
CGGTCGCCCATTGCGCCGGCCACGATATAGACTGCGATAGGGAGCACAGTCACTGGCGCGAGTCCTTTCTCGTCGATTTGCGTGATCGTTAGGATCACCT
CTGTTGGGCGCGAGACCGACAACGCAAAATGCGGGTTGGCTGCAACAGCGCCGTCGGGGTTGTGGCGCGTCGGGAGGCCGCCGGCCGTGTCTGCCTTGAC
CGACCAGTTGCCATGAAACGTTTGCGTGAGCCATTTCGCGGGGTCGTAGTACTTGCAGATGTAGAGGCACCGGAACGCGTTGCAAAAGTCGTCAAAGCTC
ATCCAAAACGTATTGTCGTTGGCGTCCGGTCGGATGCCGAGATGCTTTTTGAGGCGGCGCGTCCAAAGCGGCGAATCGTCGCCCCAGTCCCCGCGCCACT
CGGGATGGTCGCCGGGTGGATTCCGAAGCTTGACGAGCTCGTGGCCGTCAATCTCACGCACGTCGTATATGACGTAGCACGCACCAAAGACGAGGCCCGT
GTCGAGGATCTCGTGGTCGGCGTTATCGCTCGAGATGGTACCAGCGCCCAGCAGAAATCGATTGCGCTTGTGCGAGAGAAGCTGCTTCCAGAGCGTCTTT
TTTCGCGCGCCGCGGGACGCTTGGGCCAAAAACACCTCGTCGGACGCAAATCCCGTGAGGTCCCGTAGCGCGTGATGCACAAAGCCGGTCTCGAGCGCTG
CGTACCCACCGTGGTATTTCGCGTATGCCTTCTCAAGAAGAGGCACCCAGAGCTCTTCAAAGTGCGCACTGTGGGCAAAGGCCGCGCCGCCACTGATGTC
CATTTTGTGCGTGTCGTCGAGGACTGGAAAGTAGTCGTCGACAATGACGGTTTCCCACTGCGAGTTTTTGAAAAACCGGATCGCGTACGCGCCCGTGAGC
GACGTTTGCTTTGTAATGAACAAGTTGTCGATGAGTGCGTCCACCTTGCCGTCGTCGACACCGTCGGACGCGGCAATGATGCTCACAGCGCTGAGGAACC
ACCCGTCGTGGAGTCGCCCAAACCGCACGTCGTCCGGGTCCGTCCCGCCGTCAAAGAGACCGGCAGTGATGTTGATACCCGTCGAGACGCGCCAGTCGAC
GATCTCAGCTTCATTGATGCACCCGGCCAGCGACGCGTATGCCGGCGGAAATTCCGGATCCACAAACTGCAGAGACCGGCCAAACTGCCCGACAATGCAC
GCGTAGCCCGACTCGATCTCTGCGAGGGCCTCGCGCGCGTTGATGATGGCCTCGGGCACACCGGTCTCGACGGCAATGCCTTCGTTCTCGCGCCGAGTGC
GCCGTGCGACGCTCTCCTCGTACATCTTGCGGCACATGTTGGCTTCGTGGGGCGACCAGTAGCTGCGTACGTCGGCTTCGCGGGCCCGCGCCGCAGCGTC
TTCGGCGTCAATCACGGCGTCCTTGCGGTCCATCTCCTGCGAAAAGGCGGCTTTTAGCGCGTGGAAGCGCGCGCGCTCTTCGGGCGTCAACGACATGAGC
CACGTGGCCACGAGCGGAATGTCGATCGACGCGTGCGACGACGTCTTGAAAATATCGGCCGGCGGGTTGATTCCGTTGGACATGAGTTTGAACCGGTTCT
CGCGTAAAAACTTCTGAAACAAGACACGTTCGCGGCTCAAGCGCGCATCGGCAGCGTTAAGAAGGAGAAGCTGAAAGTGAATGATACAGCGCGTCTCTTC
GAAAAACTCGGCATCGAGCGCCACGTCCCGACCCGGCAGTGACCGCAATAGCGACAACGTGTCTTCTGTCCCAGGTGCCTCCACGTCGTCGTCGTCATCG
CCCGCTAAGGGCGGCAAGACAATCTCGTGCTCCTCGGACGCCGTGGCCGCGAATGGCATTGGGATCGGTCGGCGCAGATTGAGACGTTTGCGGTCGGGCA
GGAGGCGCAACACCCGCTGCGTATATCGGTGGGCTTTGGTATGTACATACGCCTTGTACGCGTACCCAAACAGGCCAATGTAGCCGAATGGCCCTTTGCC
ATCACGAAGCACATCGACGAGGATCTCACGCAGCGTAAAGAGCGCGTCTCGGCGGCGTATGGTGCGGCCCTTGGTCGTAACACGGTGACTGCACTGCCAC
AGCGTCTCGTGGATCGTGAGGGCATTGTCGGCAGCTGAGAGCCGAGTGGGTGGCGCCGCATTGGCTTCGGCGGCCATTGCGGCAGCAAGCTGCGCCGATT
TTTGCTTGCCGTACGATAGTCGCTGGTACTCGAGCTCGGCTTCCTTTTCTTTTTTCTCGCGCTCGAGGAACTCGTCCGACTCGAGCACGAGGGGTCGTCG
GCGGTCGGCAAATACCTCTTTGGCGACGGTCGCTGCTTCGTGCAGAATCGCTTCGTGGACGTACTTGGTCGCAAGGCCCATGCGTACGGGCGTGATCGAG
CACAGGTGTGCGGTGAACCCGACGAACGCGAGAAGCGCGAGCGAGCAAAGGCCAATACCAAAGCCGAGTGGGTCCGTAAACATAACACCGACGCAGCCCC
ACGCAAAGACGACGCCGAGCGCCTTGTAGACGTTGGCGGCCTCCTGGTTTTCGTTGTTGACGTTGTTGGTCGTCGCATTGTACGAAAATATCGGAAACAC
ATAGGGCGAGTAGAAGATTTGGAGGTCGGGCTCACGGCAGAGCTTGATCGCGACGCCGTTGACGCCAAGTTTGAGCAAAATGACAATGATGCTAATCGAG
AAGCAGTAAAACAAGTTGACGCCAAAGAAGAGTGCGAGCGCGATAAAGAACACGGCCGTGCCCACGACAAGCTGATTGGCGCGGCGCTGCGCGAGGGGGG
CGAGGTAGTAGTCGTTCCGGACCCACTGCAGTAGAAAATAGACGACAACGCTGAACGTTGTCATGAGGAATGCAAAGGCGCCGCCGATCGGGATCGATGC
CCAGATGAACATGATAAAAAGGAAGAGGACGGACCAACCCGCGCACGTGATGAGAGCTGATCGCACAAACGGCGAGAGCACCCAATTATCATCGTGCCAC
TTGAAGACAGCGACGATGAAGAGCAGTGTGAGCGGGTAGAAAATAAGGACCACGAGGATCCAGAGCGACTGCACGTCGTTGACGTCGAGCTCGAGCACAT
CCACAAAGAGCGCGATACCCAAGACCCACGCGAGTCCGTACGAGAAACGGGCACTAGCGCGAATGTCCGACGTGATCTCAACAACATGGTACCACTTGAA
GACGGGCGATACGGAGAAGATGACAATATACGACCCGACCCAGATGGCCTCGCCAATCCACGGCGGTGCTTCCGTGAACGTGGCGCAGAATCCGTAGAGG
AAGATACCGCCGAGTAGGCCAGCAAAGCAGTGCAGCGTCTGGTACTCGTCTTCCAACAAGTAGCCGCCCCGGTAGGCGTCGATGACGCTCATTTTTTCAA
AGTCGACCTCGGCCGTGGGCACAACCGAGTACTTTTTCCATGGGTGAGCCAAAAAGCTGCGGGCGTTGGCTATGGAGGTCCGAAGCCGCGCACAGCACGA
CTGGCGCGGCGGCGCCACGACCGTAGTCGTGCTCGGCGCTGGCGGCGCGTCGAGGATCTCGATATCACGCATCGTTGGGTTTCCATCTTCATCGACAGCA
GCAGGGACTGGCGGGGTATCAGCGATATCGGCTTCCTTGGCCGCAGCCTCCAGCTCGTCATCATCGTCGACGCCAGATGTCTTTTGGTTGTTCTTGTCAT
CGTCATCTGGTTTGCTGCTCTCAGCGGTCTGGCCCGCGAGTTGCAAGACTGACGAAGCGGCACCGCCGAGTCCCAGAAGCGCACTGCCTTTGAGTACGGG
CAATGGTGGCATTTTGAACTCGGTGCCGGGCGCCGACGCTTGGAGCGACGGCAGCACAAACGCCGACCGGAGTGCGTCCGCCTCCTTTGCAAACTCGGCT
TCCTCATCGAACGCATCGTCGTCCATGTCGTCGTCGTCGCCGTCTTCGGGTGGCCACACGACGAGTCGGTGGTCGTTTCGGCGCCACTGCGCCCACACCA
CCGTGCCAAGCATGAGAAGAACGGGTAAAAACACCGATGTCAAAAGGACAAACGTCGATTGCGTCGCTGCAAAGAGGAAAAGCCCCGAGCACACGACCAG
CAGCTCCGAGCCCGCTGCGAGAACGAACGGCAGCTTGAAGCCTGGGACACCCAAGTACACGTTGGCGCCGTGCTCCGAGAGGAGGTGCTGCTTCATCAAG
TAGAACGCGCGCGACGACGCGAGTACGAGGCCTGAGAAGAGCACGAGCACGAACGCAAGGACACCAAAGACGTAGAGCGGCCAGCGCTGCCCGATTATCG
GCAGCGTCACCGTCGTCGTTGCCGTGAACGCAACGCCGACGAGCAAGAACAAGAAGAAGAACGATAGAAACCCAAGACCAAACTCGGGTGTCGCACTCAA
ATCCAGCAGCGGCGGCTTAGAGCCGTCGTGGCCAAAGAACGTGATCCCGCCGGCTTCGCGCGCGCCCATGCGAGGAAGGTTGCGGCCAATGATCTCCCGA
CAGAGCGCCGATCCGATGATCGAAAATGCCATGGTTTGTCCGAGGAGCCAGTACGTGCCGCACGAGACGACGAGAGCGACACGACAGAGCCCAAGCAGCA
GCGAAATGTACCCTGCGGACCACGAGAGCTGGCCCCGCCACACAAGAAGGAACGTGGCGTCAAGGATGAAGATCGTAAAAAAGATTCCGATGCCTTGGGT
CGGGTAGGCGCTCCGGAAGACGGCCACGATGGTGTAAATGAGAAGAATGCCGAGGGCGAGGGCATAGCAGCGACGATTAGTGCGCTTTTGGTGCTCGGGC
GGCGTCACAAAGGCGTTTTGGAGGATATCCGCGAGCTCAAACCCGGGGATGGTGCGGGCGACCGAATAATGGGCACCGAGAAGCGCGTCAAAGGCCGAGA
GTGGCTTGACGCCGCGGTCGTGCTTGAGTGCGTCCGAGGCAGCGGCGAGCTTGACGGACGCGTCCCCGAGGTGCTTGGCGGTGGCTTTTTTCAGCGCGCT
CGTGTGCTTTTTTGAAATCGTGACGACCGCGAGGACTTGCGCGAGGGATTTGCTCAACTGGTCGTCGTTCGTAAACACGAGCCATATCATTGGCATCATA
TTGAGCGAGAGAAAGAACGCTGTGAGCGAGAAAAAGTCGACGTTGGCGCCGCCGAGAAACACTTTGGGGTCGGCAAAGATGGACGAAAAAAGGAAGAGGA
AACCACAAATGCACGCGAGGCCTAAGGTCACGCGCACCTCCTTGGTCATGCGCCAGCCCATTTGCGTCCACTTGCGCAAGCCGTAGTAGCCGACAAGGAC
GCCAGAGCCAATAAAAATGAGGAAAAAGCCCACGGCCGGTGGCTGCACGGTCGAAATGGCCGTGAAGCCCCACGTCCAGAGAACAAAGAACGGCGACGCA
ACGCACACGTTGACGGCGATCTGTGCATAGTAGAGGTGGCGTCGAAAGGTGGCGTTGGCCTCGTCGTCTGTGGCAATGCCGTCGTTGTAGCAGAGGAAGA
GAAGAGAGACGACGGACGGTGGGGGCTTCTTGATTTTCTTGGTAGGCTTTGTAGCGTCGCCACTTGTATCGTCGTCCTCGCGCTCGATGACTTCGCTTGC
GATCTCGGCCAAGTACGCCTGGACGCGGTCGAGGCGGAAATGCATCTTCTTGCAGTAGCGCACGGACATGAAGAGGAGGACCGCAAACGCAATGCCAAAC
TGCAGCGCCGAGAGGAAGAACGCGGTTTGGCTAAACTCTTTCGAGTAGATCGGCTCGAGGTCAAAGAAGCCTTCGTTCGGTACGAGCACGATAAAGTACA
TGGAGAGCGTAATGTCACGGTTGGACGCCTGGATGTTGGGTCCGACGACGATACCGCCGCCCAGCGCGTCGCCGTACATGTTTACGGGCGTCGCCGACAC
GTTGCGCGTCATAGCGACAAAGTCGTCGGCGATGTTGACAATCTGCGCCGACTCTTCTGCGTCCACGTAACCAAACTCGGACGTGAGCCACGAGAGCGTC
CCGTACTTTTTGTCGGCGTCGACGTCGGTTTGCCGTCGAAACACGTACATGGCCGACGGAAAGTTGATGCTGAAGCGTCCGAGGGGCGGGAACCCATACT
GTCCTGCTAGCGACGCGTTGCCGTAGTCGTTGTTCATGCCCGGGTTGTTGTCCATGCGGACGAGGACACCACCTTGGGATTTGGCCATTTTGTAGTACGG
CTGAAGTCGCTGGTTCCCCGGTGTCCAGACACGGCCATAGATCGTCGACGTGGCGTCGCCATAGTAGCCGCCCAGACCCATGGCCATCGTGGCGACACGC
GTCGTTGCATATGTCTCTTCGATTTGCACTTGGAAGGGCACGACGGTTTGGCGCAGGCGAAGGCACGGGAGCGTTGTACTCAAGGTGCCGTTGACAATGC
ACTCCCCAGGCGCGAGTGGCAGCCAAACCTCTTCGACACAAACTGGCTGCAGTGGCATCGCAAACGACGAGTCCATGCCAGCGTTCGGTGTCTTTTGCTT
GTATGCCGTCAGTGCTGTACAATAAATGACGTTGAGGTTGAGGCCACCAATAAAGTCGTCGGCAAACTCGAGGCCGTCGTCCTTGTCCCAAGCTTGAAGC
GTGAACCCTTCGCCCGCGTACCGGTACCCAAACGAGAGGTCGCGGATGGTGTCTTTGTACCCGAGGCACCCCAATGTCCGACACGGCGCCCAGCTCGGGT
TGAGGTTGTTGCGGACGAACGACGAGTCGCGCGAATTTGAGCCAAATGCGACTCGGATAAAGGCGTCTGTGAGTCCGCCCGCGGCGCCAAAGCCGTCGAG
GTTGGGCAAATTGCGCATCTCGATGACTGTGACGGTGAGGTTGCCGCCCGCCGACTTGAACGTACCTGTGTCTGGACAGAGGGTCGGGCCGCCGGCGCAC
GAAAACGCATTCGAGAGGTTGAGTGCCTCGACACGTTTGTCGGGCTTGCCCGTGGCCCGGCCAGTTTGGCCGAGCACGACGACGCTGAGCGTCGCCGCAA
CGACGGCGGCGACCACAGGCGCGCCCATTGATGCCGACGTTTAAATGTGTAACGACCCGACGCAATGCAACCGCCAGTGCCAAACGGTTCAACCACCAGC
CACGACTACAAATGTAGAGGCAGCTCCGGAATACGAGTGCATTAGATGAGACGAATTATATAGGCTCTGGCGCTCGTCTTTGGCTTGCGGCGCGTTCGAG
AATGCTGGCTTCGAGACGGCGAAAGAGCGTCGTAAACGTACTTTGTATGAGCGCATCCAAGCTTGCATGGGCGTCACTTTTGTCGACGTCGAGTTGCCGC
AAGAGCGTTTCAATGCCCGCGAGACCATCGGGTGCTGGCCGGGGGCTCGCTGCTTTCAAATACGCTCGGTACACAACGTCGGACCCGTTGGCCTCGATGC
AGATCCTAATACACGCTGTATGTACTACAAACTAGAATCAAATGTACCAGCCGTGCTCGTCGTTGACGTAGCCGTCGACCGGATGGGCCTCGTCGTCTAG
GACACTGCGCCACACATAGGTAATGCGACCGTCGAAGCAGTAGCGCTTGACAAGCATGCGCGTCGTGACGTGGACTGAAGCGTTGGAAACGACCTCGAGC
GTATACAGCGTCGTGGCGTCAATGACACTCGCTCGTGCGTCCGTGACGGACCCGCCCTCGACGAGTGTGCTGCGGTGCCGTAGCACCTCCAGGATCGCTA
CGTCGACGGCCGCGAGGCTCATGTCTGGAAACGTTGTGTAGCGCGCGCCTTGTGAGCTCAGTTGGTGGGCATCCGAGAGGAGCTCAATGCGAAAGACGTC
CGTGTCGGGCTCGAGCAGCCCTGTCGCAATCATCTCGGATTCGACGACGTCAAACTGGCGATCGGCGATGGCGTGCATCGCGCGTACCCGCGGCGCAGCG
TCCGCACACAAGGCCAAGAATGGACGTTGCGCATCGAGCATCTATAGGCGATTGGGAATGTCAGGCAAATTAAATGTCGAAAGGGTACTGTTGGCCACGT
CCGTAGCGCGTTCTCGAGATGGGCGCGGGCGACGCGCTGCTCTGTCAGAAGCTCGCGCAGCACTGCGTTGGTATGTCGAGCTCGCAACAGCTGTGCGTGC
TGGCCCATTGCATGGCGGCCCCAGAACGACAATGCCTTGGCACTGTGGCGGCTTTGCAGGCGACAGAGCAGGACCTGCAGAGACGCCTCCTCGTCCTGCA
GAGCTGCCACGTCACGCGCCAATGTCTTCTTGCGCACGCGTTTTGGTGCCTTTGGAGGTGGCACGTCGTCGAGGAAGGCCAGCGCGCTGTCGTCGACCGG
CAGCATGTCCAGGAGCTCCATCTCGCCGGTATTCCAACGTGTCATGCCCAAAATGAAGCGCCTATCCGGATATTCTCTGTCGTATCCGGTAAGGCAGGTG
TACTGGACCTGGCGTACATGTACCCTTCGCAGGGACAGCTCACACTGACTGCAAGACCGAGATTCGGCCGAGTGCACTTTCTATCGCGAGGAGATACGAG
GACATTGCATGTTGAGGCGAGAAGGAGCGTCAGCTACTTAAGTTAAGCTCCTGGACTGCGCACTTGGCGTGCACCTCTTGCTCAAATTGAGTAAAGAGGC
TCGCAAATGTCTTGGAAATGGTATCTGTGATGCCGTCAATCGTCGCATCCGTCGACCGATGGGCGGCGTCAATGCGCAGCATGTCGACGAGGCTGCTCAG
CGTGTCGAGTTCGTCCACGGGCGTTGGACTCGCCGCGCGCAAGTACGCTTTGTACCGTGTCATACCGTCGCTGCACGGTGAGTACTCGACCCTATTCATA
GCGGATGAGACCATTGGGACAGGATGTCAATGGGTTTTAACCAGCCGTGTTCGTTGTTTGTAAAGACGTCCGACTCGATCGGTCCTGCTTCGTCATGGAG
GACACTGCGCCAGACGATGGCAATGGCGCCCGACGTTGGGTTGACGTAGCGCTTGGTGATCATGCCCGAGACGACCTTGATGACGCCATTAGGATGCACA
AGCTCGTCTCGCATGTACGTCGTGTCGTCGTCGACGTGGAAGGTGGTATGGTCGCCGTGGAAGGCGGTGAGGCGTCGCCGGTCGAGAATCGTCTGATGCG
CGGCGGCCGCAATCGTCGCCACGTCAGCCTGGAACGTGCACGAGCGACTTCCTTCGGAGACAACGCGGCCTTGCATCAAAGTGGTGCGAAAGTCCAAAAT
GTCGTCGCCGTCCGACTCGAGAAGGCCAGCGGCGATCATCTCCGACTCGAGAAGCGCGTACTGGCGGTCGGCAATGGCGTGGATGGCTGCGATGCGCTCG
CCGGCATTGGCGTCCAGCGTCAGGTCGCGCCACTTGGTGTCTTGCAATTGCTTCTACGCGCGCAATTACACTATCGTCATGCGAGACTACACAAACGTAC
GTGCAGTGACCACGGCAGCCTCCGAAATGCGCGCTCGAGGTACTCGCGGAAGGCCGTCTGCTCTGTCAGCGCAGCGCGCAGCTCGTCGTTCTCGCGCAGC
GCCTTTAGCTTCAGCGCGTTCTGTGCAATTGCCAGGTTTTGCCACTTGGACGAAGCCTTGCAGCTGCGGCGGGCGCGCAACTGCGCTACCTCGTCCTCAA
GATGGCTTTGGGCCCCGCGGAGCTCGAGCAGCTCGGCCGCCATTCGGTTGATACGCACGCGCTTGGGCTTTGTCTTGGGCTTGGCCAGCGGCAGCACGTC
GTCAAGAAAGGCCAACGACTCTTCGTCGGCGGGCGGCAGCCAGTCGAGGACCTCGTCGACGCTGAGCTCCATCGTCGGCGCTTCCATGCATGCGCCTGGC
TGCGACAACAATCGTTTGCGTTCTATAGGAATGTACGTCAATAGGCAGAGCGATGATCTTTTCGTCGAGTTTTGCACAGGCCGTTTCGGGTGAGAAATGT
GTTTTGTGCGTGGGAAATAAAATCCAAGCCAAGCGACGTCGCGCCCATGGACAGCGACGACCTAGCGGACCTCGACCTCCTCGACTTGCTGCCCGCAGCA
GACGTTGGCTCGCTCGCCTTCCTTGATGTAGCCGCGCCCCGGAAACGCCGGCGGGTCAATCGCTTGGCCGTCGACCTCGTGGCGCTGCGCGGCCAAGCCG
CCGAGCTGAGCAGCTGCGTCGCGGCCTTGCGCGCCCAGCGCGGCTGCCCCAAGGAAGCGTCGCCGTACGGTCGCCTCGCATTGAAGCAGAAGGCGCTCAA
AGACCGAGCGCTCACGGAGCAGGCCGAGCTGCGCGCGCTGCTGGCCGAGCAACATGCATTCCGCGCCTTTCTCGAGAGGGCGCTTCTCAAGCGTCCGCGC
AGCATGGTCCGTTGCCCTCTTTTTGCGCATGTGCACAAGCGCGCTCTTTCGTAGATGCTCAAGGTCGAAGACTCAAAATGGCGCCGTTATGCTCTCGGAG
CGACGGCCGAGGCTCGCGTATCGGCCATCAATGCCATCGCGGACCGGCAGTACGAGCTCCTCGAGTCCGAGATGCTTGCGAAAGGCCTCTTCGAGCCATC
GGAAGATGTATTCAACGTATTCACAAGCCTCTCGGACTGTACAATGACATCCGAGGCAATGCGCTACACGACGCTGCCCGTCCCCATGACGCGTGCTGCC
GCTGTCGCGATCGAGCTCATGCGGGAGCGCCACGCAATGGCTTCATCCGCGCAAGATGGCGACATCTATGCGCCGCACGGGCACACGTCCCACGACATGC
ACCGCATTGACGACCGCACGACGTATGTTCGCAGCGTGTACGCGCCACCGGGTGCTCTCGTTGTGACGTCAAGCATGATCACAAAGACGTACGAGCAGCA
CGGTGTCGTGACGATCGTGTGGCGCAGTGTGCTAGAGGATGAAGGCGTCCCGCGCATTCCAGCGTCTTTTGTCAACGACGAGCACGGCTGGTGCGATCAA
ATGCATGAACACCCATGTTCTTCTGCTACGACTATGTACATTAGGATTCAGCTGCGCCAAGACGACGCAGAAACGACGCGGTACACAGCCTATGTCCGCG
TGGCCAACCCAATCGCACCGCAGAGCGCCGACGTAGACAAGCTCGACGATCTCATGCAGATGCTCTATGTCGGGACAAAAGTTGATTCGCTACGTCAAGC
CGACTTGACTGCGACCGTGCAAGCATCGTTTCGGGCCATGGTTGCGCAGTTTGAAGCGCTCGTTGTGCAGCGGGCTTCGATTACGACAGAGAACGCGCGA
GACGTCCAATAAGCAAGAACTACGTGCTTATGTTCTAGATAACGTGAACCACCTTCGGTCGATCACTACTATCAATGTCCATATGGCTTGTATTACCCAT
ACACCGAAAGGTTTGTGTACATTTGTACTTGTACAGGAAAAAAGTATATTACAAAATGAGTTATTTGGCCATGAGCTGAATCTCATGTTCAAAGTGGGTT
GTGGCGCGAACGAACGCGTTGCGCACCGTGTCGACGAGCGTGTCACTCGTGTTTCGGAGTGGCGCCGCGTGCTCGGCCAAGTCGATCATTTGCACGAGGT
CGCTCAGGTGATCGACGCTGCTAGAGACGTGTGGCACGGACGAGCTCAGAAAGACTTTGTAGTGTACGTGCGCCTCGTCTTTTTGTTCGAAATAGAGCCT
ATTGCGATATTGAGACGCCTAATTCAAAGGGCATTTGACGCACCAGCCGTATTCGTCATTCACAAAGCTGCCAACGGCCGGCGGCAAGAGCTCGTCGTGA
AGCACACTGCGCCACACGACGCACACGTTGCCCGTCGACGGCTCGACGAAGCGCTTGATGACGAGGCTCGTTGCCACTTGCACCTTGCCTCGCGGGTGCG
TCAAGAGCTCCCGCGTGTACATGGTGTCGGCATCCAGCATCTGCACGTGCTTGGTCGTATCGATCGCCGCCGAGTGGCGGTCGCGGGCCGCAGCCTCGCG
CTCGAGAATCTCTTGGCGCCGCCCGAGCACCCCCATGGCCACGTCGGGCACATGCGCCATCGCAGCTTGCAGCACCGTGTACCGGACACCCTCGGCCGTG
CACGATCGCGGGTCGTGGGTCGCGAGCTTCACCTCGAGGAGGTCCGACAGCATTGGGCCAAAGAGCCCTTTCGTCACCATTTCGGTCTCGACCATTTCAT
ACTGGCGGTCTGCGATCGCGTGGATGGCAGCGACGCGCGCGTCACTCTCGGCGGGGAGGGTGAGCGACCGCCAGCGCTCGTCGACGAGCTTGTCCATCTA
GAACATGACCTCGTCCTCGACGTACTCCTATATAGAGGACGTACAATGGCAGTGATTGCGCGTGGCCGCTTGAGCAGCATGCGCTCCAAGTAGTCGCGGT
ACTCGTTCTGTTCGGCAATGTACCCACGTAGCTCGTCGTTGTCGCGCATCGCCTTGAGCTTGAGAGCTTTCTGGTTCATGGCAACGCGCTCCCACTTCGC
GTCGACATCGGAAAGGCCCTGGACCTTAAGGGCGGAGACGCGCTGGAGGTGGTCGAGCTCGGCAGCGAGATGCGCATGCTCACTGCGCAGTGCATCCAGC
ACGGTCTTGGTCTGGACGCGCTTCCGCCGCTTGGCACGGCCCGTTGGCGAGATCTCGAGCGCTGCCGAGCTCTCGCTGGATGGCGCGTCATCTAGAAAGC
CGAGAATATCGTCCGACGGTGGCGGCAGCAGGTCAAGAAGGTTCATCGCGGTCTGACCTCCTCACCGCGACCGTGGCGTCGACTTGATTACAACATCAAC
TGGTCGGCGGTAATCAAAAGGTCAGATATTTGCTGTATCGGATATTTGCCAAACTACAGTATCAGCCCGAATCCGACCCAAGTCCAGCGGTAAAAACGTG
TGCACAATCAAAGAGATCAGACGAAATGTAGTGCATGACGCCGCGTTATCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN