Description :
From Genome Similarity Track
Location :
Scaffold_974:869- 1957
Transcript NameFunction/comments
Phyta_totarag11602hypothetical protein

Sequence
1088 bases(100 bases per row)
GGTATCCTCCTGTGCCTGCACGACGGCATCTTGGAGCTCGGTATTTCTCTGATCCGCGAGTTGCGTTGCTTGGGCAACAAGGAGCCCATTGAGGTGCACC
ACTGCCACGACCTGACCAGACCTTCTGTTGATCTCCTCTTCGGTATCGATGAGAACATTCAGGTCGTTGATCTGTGCGAGCGGTATGTGATCAAGAAGGT
TTTATCGGACGAGATGGCCAAGAGCTTCCAGAGTTACTGGATTAAACCACTTGCCGTGCACTTTACTAGCTTCGAAGAGCTCATTTTCCTAGACGCAGAT
GCCATTCTGCTAAAGGATCCAGCCGCTCTGCGCGACAACGAAGGGTACAAGAAGAATGGAacgctcttcttctacgACCGTGTgatcaacaacaaccagt
ACTTGAACAAGCGGAAGGACAATGGGCCAATCTACCTCCACCAGTGGCTCAAGAGCTTTGACTACAAACGCTTCGGACTCGAGTATGCTGATCCGTCGCA
GGCTTTCAAGAATTCCTTCGCTTACCGCGGCAAGACTGCTCACGAGCAGGACTCGTCCATGCTTTTGATCAATAAACGCTACGCGAGCAAGGCCATGAGT
GTGCTGTGGTTCCTCATCACAGAGCACCGCTTCATCTACGAGTTCTCATGGTGCGTCCACCTTCTATCGGCTCCCGGCTGTGACCATGATGCTAACGCTT
TTGTGTTTTGGTTTTGACCTTGTAGGGGCGACAAGGAGGCCTTCTGGCTGTCGTACGAGTTCTCGCACACTCCATACTTTTTCTCTCCGTGGGGAGCAAG
CGTCGTGTCTGCTACGCCCAACAAGGACATGGAGCGCCACCCAGACACGCTCTGCGGTAGTTTGGCGCACTTTGACCCGACGCTGAACGCCAGCGCACTA
CCCGAGCTGTTGTACGTGAATGGTCGATCACTCGTTGACCCCGTGCCGTTCCGCCtgcacaagctcaagctgctgcagccgaaCCTCGTGTTCAACATGC
TGCCGACCCACGTGACTCCGCGACAAGAGCGACGTGCTCCCGCCGGCAAGGGCGAGTGGCCCGAGTGCTTGACTGGCATGGGCTCGAC