Description :
From Genome Similarity Track
Location :
Scaffold_1361:8686- 10332
Transcript NameFunction/comments
Phypl_g13216hypothetical protein

Sequence
1646 bases(100 bases per row)
CAACGTTAGCGGAAGTCGGCCCCAATCCGCGGCAGACAGCAAAGCATTGCGATGGTCACGAGGCTCGCTATTCACGCTGTGGTCATTGGCCCGATCAAGA
TCACTCTGACCCCCCGCTGACGCGCTTGAGGCTGCACCATCACGCTCGGCCGAATTCGCAGCAGAGCTGGAATTATCCtttccgtcgctgccgctaTTGC
GATCAGAATGGGATCCACTATCAGACACGGCCGAATCACTATCCCGGTCAGAAGACTCGTCGGAACCTTCGGAGGAGTCAATACGTATTGGCTGATTAGG
AGATCCGCCACTGGAGGCTCCAGATGAAGAGCGCCGGCGGAGAGAGGCCCACGACTGTGCCACCCCTGCATGAAGAGGATCGTCGCTCACCGAAGAAGAG
AATGTGGATCGTACCGAACggctggaggcggcggctcgtCCTCGACTTCCGCCCCGAAGACGTTGAGAAGCAGGCGCGGAGGAGCGATCTGCTGACGTCT
GGGTGGGCGAGGGTCTCGGACGGGAAAGCGCAGTGGTGGCAGATCGAGCAGGTGACGCAAGCGGGGCTGACGTAGAAGCATGAGGCGAGCACCGAGATCG
CCGACTAGGACGAGCGGAAGTCGCAGTTGATCGAGACGACCCGCTGCGACGACGCTTGGTGTGAGAAGAGGCCGAGGCCAGATACCCAGCGGGAGGAACG
GTCGAAGCAGCCACGGTGGCCGAGGGAGCCGTGTCCGGCTGTACGAAGGAGACCAGCCCCGCCACTCGATCACGGATGGCGTCTCGATCACGGGTCACCA
TTGCATGCTGCGTCTGCAAATCCCCGAGCGCATTTTGCGACGCAGTCAGCTGGTCAGACAGCGACGTGTTCGCTTGTTCCGGCAACTGGATGCGGGATCG
GTTCGCTTGCAGGTCGTTGACACGCTGTTCCAGTCACGCGACGGCTGCACGAGCGGTCGTAATTTGGGATTCTGTGGATGAAACAGCGGATCAAGTTAGT
GGCCGAGTGGCGGAGATAAGCGGGTAACGCCATGTACGTACGATGAGAGTGGAGGTCGGCCCGTGCACGACCCCTTTCACGCGTGACCCGTTGCAGGTCG
GCAACCGATTGTCCAAGCTTGACGGTGGTTTCATCAGCACGCGCGAGAACGCGATCACGTTCGGCGTTGACGGTGTCAAGGTAACGTTGAGATCGGCGTC
TCTCTTGGTCAACTTGAGCTTGAAGATCAGTGGCATGGCGCTCCGAATCAGCGATCCGTTCGTGCAGCCCCGCTTGGGCAGCGACGTAAGCCTGCTGGAG
GTCCAAGTGCGTCTGCTCCAAGTCTGCCCTAGCGTCGGCATACGCTAACAGATACGCGAGCGTGCAGATTGACGCTTGTACGGCACTCCGGTCGAGAGGG
ATCGACTCGACGCGAAGCGTAGGGGCCGGAAGGTCGTGTGAGTTGGCACCGTTCCTGTGGGAGAGACGGACGACGCAGACATGCCGCCAGGAAACTTGAG
TCGGGAAGGCAGAAGAcggagagctgctggcgggaTCTAGGCAAGAGCGCAAGAGAGGTCGGAGAGCACAGAGTGGTTAGGACGGCAATTCAAGAGATGG
AAGCCGCTACACAGATGGAGAGGCGGGGCTGCAACAGACTGCGCTC