Description :
From Genome Similarity Track
Location :
Scaffold_248:8684- 12351
Transcript NameFunction/comments
Albla_Nc14107380PREDICTEDx3a copia proteinlike putative

Sequence
3667 bases(100 bases per row)
CGATATATTTGGTTTCGCAGTCGAGATATTCGCGAGTTTGCATCGATCAGAGTGAAAAGCAGCTCCGGTTGCGCATTTCTGCATCAATCTTTGTCAAATC
CACGCGATCCGGCTCTCCTGCTTCCCGGAAGTAGTTAATCCAGACTTGTTCCGTTACTTCCATTGCAGATTTTTCCATTTCAAATTTTAGGAACTGTTCT
TTTGTCCATACTTCCACGCAAGCTGATACCGGCATGACGAAAGGTTTATTCTGGCATGTTTCGTAAGCGAGCAACGTGTTGTAATAATCTTGGTATTTCT
TCACAGACTCCCTCTTGTCTTTTGATGTCTCCCCTTTTTACATCGGTTGTGTGGGGAGTTGTGGCGCGTTGGCTATCCGATCCTCTCCTGCTACATCCAC
CATCTCGCAATCCCCCGTAATTCGTCGGACTCGTTCTTCCGTTAGCACAATGAAGCGTCCCGATGATTTCAGTTTCCGAAACATCATTTTCTGCCATCGC
GCATCGGAGTCGGGTGCCATTGCCTCTAGCTCCGCGTACATATCATCGTTGGTGCTGATCTCTTCACTCGAGACACCGCTTTCAACTTCAGCTATAGGGG
CTATTCCTCAACCTCTAACAAATCGCACTAAAGTATTTAACTAAAGTTAACTTTGATATCTTCTATGCTTTCTACTTGCAGATCCCCGTGACTGCTTCGG
GATCTGCTTCGACCTAGTATTAAAAAAACGTAAGTGCGTGTATTAAGATCTTTTAGCGGTTCGGTCTCTTAGATACGGTATCTCGTGTCTGTAAAAGATA
CGTAACACACATCAGTAGCACCGATTTCAGACTGAGGTGCCACTATGATGATTGACCTAGATTTTCTAGTCGCGGAGGGATGATTGCGCTCGAAGATGTC
AACTTTATCTGGCATCTGACATCGAGGTCATTTCTGATGGTGTACAGACCATGGAAAGTTTCTCAATTTCGATCTTATTTCGTGCACAAGGTTTTCAATG
CGTTGCCGGTAGATTACGCCAACGTCACATTACAGAGCAATATTATCCCACGTCAAATCTTATTTGCGAAACTTGGATCTTTTCCAGCGCGTCGAACATA
GTTTTGTATATTCGCGTGACAAACTACAGCTGGGTCGTCAAGTGTGCTATAGATAGAATGCTTCTTTGATTTTGTTGACGATATATCTGATCGTTTGACT
GCTCATATGATCTCAAACCTGCATTCTAATTGGTCAATCAGGATGCCAAAAACAACACCCTTTTGAGGGTGCGACCGTTGCCTCAGACGTTTTCAATAAC
GCCATAGATAAGAAATATTTTGGATGGTCGACGACAGGCCTGTTATATTGCTGGTCCAGGTAAACAACAAATGCCTGAGAAGTTAGTCCCTTTGCAGCAA
GATTTAAAGATGCGTACAGCACGGTTAAAAATGTTAGTTTGGTAGCGTATGCTGCGTGCGTTTTTGGAGTAGAAGGGAAGTGTTTATTTTTGTTTACCCT
AAGCGTAAAGTGCTGCTAGAAATGTAGTACCTGATTCGTGTAGAGAGTGGTCGGCCGACTCATACTTTCTTGCTCCAGTACGACCGGCATGTCGGTCAGT
TTCCTATACTCCTCCTTGGCCGTCGCACCCTTTGCCCGAAGTCTCCACTAGCGAGCCATCACTTACCTGAAGTTGAACTGCTCCCTCGGTTCTGCCATTC
TAGGCGCAGGCAGCGCCTTCGTCAAAAGGTCGGCCATCATTAGCCGCCACTCAATTTATTTGGGTTTCACGATGTTTCTCTTTGCAATGTCGCAGATGAA
CTTCAATCGCACGTCGACATGTTTGGCGCTATACATGCTGTATTCGGCTTCCAGTTGCCGGATAGCTGACTGTTTGTCCATAAACATCGGCATTGGTACA
ACTATCATGAGTCCGATCTCTTGGAGCAGCTCTCTCAATCCCAATGACTCGCGTCACTTGTGAGGCCGACGTGAACGCAGCCTCCATGATGGAGAGCGAC
ACCCCAACTAGCTTCTTGCAAATCCACTGTACTGCTGCTCCGTCCAAGGTGTTTACTTCTCCAGTGACGGATTTCCTGTTTACTTGTCTGCAGCAAAATC
GGAATCGCTCCAGCTTGCAGTTGAAAATCCTTTGGGGTTCTTATCGGTAATTCGCATCTCGAACTTCATGCTCTTCGTGCCCTTCAGGTATCGCACGATC
CTTTTCGCCAATTTCCAGTCGTTAGTCGTTGGTCTGTGAGTGCGTCGAGTTGCCTTATGTACTGCAAAACTGATGTCAGGCCTCGTGCAGCGTGCCAACC
ACAGCAAGCTGCCCACGAGTGACTGGAAATCTCGCATGGTCGGCTCATTTTTGGTGGATGATTGGACTGTTAAAAACACCGGATCATCCTCCGTATCGTT
GTTTTCCTCGCCTATTGGTGAGCGTACTCCCTTCGCGTTCATCACGCCATGTTGGTCCAAAACCCCCTCAAAAGCGGCCTCCTGATCCAGCAAGTATCTC
CCATCGTTCAGTGCCACTCGCATTCCCAGAAATTTGCTTACTTGACCCAGGTCCTTAATAGACAAGGATCTCATTTCGTCAAAAAACTCGCGGACCAGAA
TTATCTTAGACACCGTCACTAACAGGTCGTCAACGTAGACGCCAACGATTGTCGTTTCGCTGTCTTGATGCTTTAAGTACAAACACATGTCGGTCAAACA
GCGGGTAAAGCCTGCATCCACCAGATTAGCGTGCTGGAGCTGACTCCACAAACGGCCGGCTTGCTTCAAGCCGTACAGTGATTTCTTGAGCCTCAATGCC
AGCTTATCCTTCGTGTCCACGCCAAGTTTATTGAGCACGCTTTCCACAACTATCATGCCCTGCGGAATCGCCAGAAATATCTCTAGTTGTTGCTCTTTTC
CTTCTTTTACATAGGCGTTGGGGATATCTCCGTGCCTGGCTGGCACACCCCAACGCAGCGCTAGTATCAAAAGCACTTTCACCGTACTTAGCTCCATAAC
CGCCGCAAAAGTCAGTCCATAATCAACCCCAAAGACTTGCTCGTTGTCGCAAGCAACTAAAGGTGCCTTGAAACGTTCTATGGACCCATCGCCGTCTGTC
TTCGTCTTAAAAACCCACTTAGTGTGAAGTACGTGGCTCTTGTGAGGTGGTACCTCTACCGCCCATAATTCGTTATCCTCAAGTGCCTCGAGCTCCTCTT
TCATCGCTATCTGCCATTTCTCTTTGAGCTCGCTTCTCATGACTTCTACATAGTTCTTAGGATCTGGCTCCCGCACGCTATTTAGCACGTTCCGCGCCTC
TCCGATTCTCTTGCTGTCATGTCGCACATTCGTTTCGGCGTCTTTACGACAAACTGATCTGGTACGGTGTATGTCACACGTCCATGCCGTTTTTTGTCCG
TGACCCTTCAATTTCTGCACTGAAACAGCTTCTAGCTGCTTATCCGACGTTTTCACACCAAATATTTCCTCCGCTTCTGTTTTGTAGGCGAGATGGACTC
GTCTCAAGTGCGCGTTCTGTTCCTTTTTCAGTGTTTTCACGTTCCTAACATGCTGAGTCACCACCACTGTTTTACTCCGAGGGATATTACTCCGGTATCG
TTTGACTTCATCACTCTTGCCGGTAATCACGCCCCGTTCTCCTCGCTCTCCAATTGATTTGTTTCTT