Description :
From Genome Similarity Track
Location :
Scaffold_352:8682- 10784
Sequence
2102 bases(100 bases per row)
ACGAAGAGTAGCACTAAATGATGCTCATGAGTTGCAATCAAACGTCGAGCTAGCGTCATTGGCCGTGCTCTGAGCCTCGACTGGGGTCAGACTCTTGCCA
CTCTGCATGTAGCGGAGCTACCCTTACTCCTTTTTCAGATGAAGACTTGTAGACTCGTAGAGTCTCTCTTAGTATATAAAAATAAACGGGTATTACCTTA
AAGGGTGCCAAGTCTTACAGACTTAGTGAGACTTAACTCTGAGTGTATGTACAAGCTCTTAAGCTTCTAGTCTTGGTTCAGGGGACTACGGCTCCAAGGA
ATCACGTGGCACTAATGCTCAATAGTACTTAGCCTTAACTCAGGCACTGACTCTTGTAACCAAAGACGTCTTGGAAAGACACGTGTCTGAAACTGATCGA
AAGGGGAACTGAATATATTTACTGATTTATAGCGATAATAAACCTTACTTCCGTCTTTAACCTTGAAACTGTGCTGCCTACTCGAAAAGTCCTCATCGTA
GTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAGACCGTATTACGATAGATTTCCTCAAACCATAACCGATAGGGTACGGTATTATCGCT
TAGCGTATGTGATACAAAAGTACGCCATATCAGTGATACTGATCTCGTTATGTGTGTATCACACCCGCGTACCTGGTTATCACAACCATTTGTATAACCC
CTTTACACCCTCCCCCCACCAATCTGTCGATACACCGAATTGACATTCTTCACCTCTCTCATTGAGAAAGCTCGGAGAGAACAGATAACCTCACGGTTGT
GTTCACGACACCTTGCGCATCAATGGCGAAATTATCGTATTCCTCCGAGTCTTTGGAAGATATCATACGAGACGAGAACATCGTCGATTATGACAGTGAT
ACTGTCGTTTAAGGGATTGAAACCCCCGAACCTGCCACGTCAGCGTCGCGCTAACCTTCGCGCATTGCGCCAAACCAGAACGATGCACGGCTCAAGCGCT
GACTGCGTTGCGTGCTTCAACCACTCTTGATGAACCTATCATCACCAACAAGCTCGATTAGCAACAGCAACGCTATATCGAGAATAATGAGAGAGCTAGA
CGTCTATCTCAGACATTATCTATTGTCGAAGCGCATTCGGACTATCGCTTCAAGCCCTTAAGCGTTGATAAGTTGGTGTGAAAGTTCGCAGGGCAGCCCT
TGAATACTTGGCCCACAGGGCGTGAGGCTACGATGTCTGACGACATTTCCGAACGAGATTCTATCAGAGAGAGATACTTGACGCCCAAAACGACGACGAT
CTACGATTATCAAATCAAATTGACGGAACAAGCACGTGGTGCCTCTGTACCGACGCAAAGAACGGCCCCGGTCGTTCTGTACCCAGGTGAGAGCGAGGCC
AATGACGACAGCACGTTTACTCGTTGGGCAAATAGGGCACGTTGGTTGCCCGACATGAGTGCCCTTCGATATAGTGCCTCCAAGGCTGACGTTCGGGTAT
AGCGTAAGATGCGCTATGAGTTTGCTAATCTAAAGGCCAAATACCAGCTACGTTCGCTGTATCTCACACAGTACGCAAAACCAGTTGCTATCAAAACCAC
CACTGTTTCGACTGTGCAGACAGTCGCGGGTCACTCGGTGTTAGTGATCGAGCCCTACACCCCACACCTATTGGTGGGAAGCGCGTTGGGGTGCAAGCTG
ACCCGCAGCGCGACGCTCTAAAACATCAACGGCATACGGGAAATCTTGCCGAAGGGTACCTGAAACTCCCATGAGTTTTCAGACTCAAGGTATCCGCACC
ACTTCACCAGACACTGGTATTGATCTTTGTGACGACGCCGCTTCAGAAGTCTCTCCACATGGAACTGTAAGTTCCCTTGCTCGTCGATCAACGCAGGAGG
GGGTTGATGTGTCGGCACAGGCTCACGAAGACTTGGTGTCAGAGGTGAAGCGACTCCGAGAGTCTTTTGCGCACGTGCAGACGGCACTGGATCATTCTGT
AACAGAGAGTAAACAACTCCGGGAGATCTTCGACCAAGTGCAACGCGCTTGTGAACAGTCATCGACTGAGTTGGCTCATTTGCGTGAGCACCGTCTCGGT
TC