Description :
From Genome Similarity Track
Location :
Scaffold_887:868- 5668
Transcript NameFunction/comments
Phyke_g11326hypothetical protein

Sequence
4800 bases(100 bases per row)
CAACCTGCTATGTCATTTCGAAGCCGGCGCCAGACGAGATCGAGGTAAGTAGCTTCGCACGAAGTACTTTGTAAGATGAGTAGGTAGGGAGCTTGAGTGT
GTTGAAGCACGTGGAGGAGCTGggcagcagctcgtcatcgCTCCGGATTGGGATCTTTTGCACGCAAAACTGGGGCGTGAGCGACGAGAAGCCTAGCGAT
GGAGCACGCTGgcagcttgtggtgaatCGCAAGAATGAAGCTTGCTCTGATGGTGTGTAGCTTACCAGGGCCTGCCACAGCCATGCGACGCGTTTGTCCA
GTGCGTAGTAACCTCCTGTGTAGCGTACATTGGCCTTGAGGTCATCAACGTCGATCTTGCCACTCTTGCCTGAGATCAGCACTTGCAACTCGGGCTCGTT
GAACATTTGAAGCCAGCGCGGGTCAATGAGATCTGACAACCCCATGCGAAAGGCTGAACACTGCTCGCGAATCTGTGTGTTGAGGTAGTAGTTCCCGACT
AAGTGAATGTAGCGCGTTTTGTTTCGGTTTGTCACTGGCACATCACCTCCACCCGGGATAATCTCAATTTCTTTCTGCTCGCCGAATACTTCCTTAACAA
CAGTGTGGGTCAGTCCAAGGTCCTCCACATCACCGTCGTAAGACTTGAGAAACATCAGATTCTGCACAAGAGCAGATACACCCCTGTCGTGTTAGCACAT
CATTTGTCCGAAAGCCTCCTCAAGTTACTTGGACTCACCTTGTATATCTCTGGATCCAGTGATGGCAATTCGTTGAGCTGGTTGAACGAGTGCAGGAGTT
tagagagaaaaaaatggGCGAATTTAGGCTGCACGACAATCCCTTCGTACAGCGCCTTCCCCAAAATTCGACCGACAAACTGGAACAGTGTCAGGTGATC
GCTCTCGCGAGAAAAATGACCGGAAGCGGAGTTGGGATTCGGGTACAACAATTGGTCATGGGTTGTAAGGAAGAGCCCGTATTGCAAATCAAATGCAAGG
GTAGACAAGTCCAACCAGAATTCCTTGAAAAGCCCTCCAGCGTCAATGCCGACTTCCTCACGGCCAGCGGAATTCACAAACACCACGTTGATGCGCTTCT
TCAAATTTGTCCGGATTGTGTTGAGCTTTCTGAGGCCGTCTTCCAAAATGGCTCCACGATTAATGCGGATGCGGTACACCGAACAGTTCTCGCTCTGATG
GATTTCTTTGTCCGCTTTGACAAGCCGCTGGAATAACTTAACACGGTCGGGGAATGGTACTAAGTATGGCATCGACTGAATCAACTTGTTGGCTCGCGGC
GTGCCCTGCAAAACTTCTTCGATCAACTGATTACTGTCAAGCTCAGCAGAAATCCtgaacacacacacacacatgcATACGCGTTAGGATATTTACAGCG
GGGGGTTGCATTTGTAGTGCAGGCCAACGAACGTACCAGCTTGTGACGTTTGTAAACGGTTGTCGAGAGCATCGGTTATACAGCAACCTCATCAGACGAG
TCGCCATGTCAACCACGAACACACCAAACGCTACCGAGTCGGTAGATGGTGCTAGATTGGCATGCGTCCAATACGCGTCATGGAGTGCACGCTTAAGAGC
CAGCACAATCCGCTCAATTTGGCGGAGAGGGAGCGGGTATTCGAGCTCATACATCTATCAAGAACAACACGGGGGATGTTAAtgcgtctgcagcacacag
cagGGTAACCAGCTCAATGATAATATCCTtacctcttcatcgtccatCACAACCAAAAGATGGTTGTATGCCATGCAGAACAGCGCCAGCATACACATGT
ACGGATCCGAGCTCCGTGCATGAATCAAATCCACGTTCTACAGATCGACAAGATTTTTAGTTTCATAGTTCCAGATCTTCATCCAACTCAAGAGGAGCAT
ACCTTAATGAAGTCTTCAAAATCTCTGGTTTCCTGCAGCACGCACCAGAGCATGTAAACCAGAGATACGCTCTGTGTTGTATCACCCCCAGAGCTGGAAC
TCTCGACAATGTCGACATGGTAAAATGCTATCGTGTTGAGCAGACGCATCGCATGGGTTTGGCGCATCCCGCCATCGTTTCCCCATCGAAAGAGGAATGT
TCCACACAGACACGCTAACGCCTTAATGTTCTCGAGAATGAAAGGCTCGGTGCTCTTGGACAACTTCAGGACTGCCATATTCTgtgttgcagatgatgat
tTCCTGAGGCCTCCCACTCCCTTGGCAGCAACATGTCGAGCGTCCTTTGAAGTGTTTTGCAGCTGAGAATTGCCTCCACTACCGTAGTCCCCCTCACTAC
TTTCTCTCCGACGTCGTATTCCTGTCTTCTCGAACAATTTTTTTGCCCAGGTTGCCTTTCCAATCGATTTCATCTTCTGCCACGTTATTGCCAGCGATGT
tgacaatgaagaagccgATGCGATGTCACCAAATCCAAATTGTTCCTATAAACAAAGACACTTTTTTGTTAGCTTTGAACGCAATTGTACGCTACTATAC
GTACTTACCGCGATTGTTGGTGCATCTGGGTACATTGGTACCGGTCGTTCAGTCGAAAACGGACGCTGAAGAGCAGTCGGAGAGAATGAGAGGAGGTGGT
TACATATCGAGCGCAGGTAGTGATCCTTAATCAAAATTTGCAATTGCTGATTCAACGCTTCAGGAAAAACCACAGGCATGGAATGTGAGCCGGATACTTT
CGTCCACGTCACTGCTACTCCGGAGGCAGCATATGTTGTGGGTGGCACGGCTTGCAGCAATTTCGTGATCAGATGAACCTCGCTCAGCACGATATTGTCC
GACTTACCCTCCACACTATGTCCACGCATGAACAATTCGTCAGATAATCATTTTCTATGCAGATAACGTGGAGCTCGTTGTAAATCTCACCGCTCAGAAA
TCCACAGAATGTTCCCAAGAAACCAAGCTTCAGACGCGATACCATTGACAGGAGAAGCAGGTAGGTCGAATACGGACAATCGCAGACCAGCACTTAGAAG
TCTATCCCATAGACACAGATccgtgaactgcagcaggttaTCCGCTGCAACCACTTGATTCAAAAGTGGCACCGAAAAGACCTGGCCAATGCACCGTCAT
GACGTCAGTTACCACCAGTCAAAAGAAATGTGCATgcagaaattgaagaaaaTAAAGAAGTAAAACCAAACACTATACCCACTCACCTCCATGACAAACG
CTTCAAGAATCTCATGCGTTGTCTTGAGGAGATGCACCATAAAGTCCATCAGTGCATTACAAAACGGCGACTCTGTTGCATGCGATGCAATTGGTAATTG
TCCTCTTGCCGATACCAATCCTTGTCTTGCAATCTGAGTCACCGATGCTCTCGGCATTTCAGCATACAACATCTTTGCGATTTGTTGCGGTGGATGGTAC
AAAATCAAGTGCCCCGAGAACAAATACTGCTTTAAATATGGCAGTATCTCCATCAAGAGTTTCACAACAGTGAACCCCACAGGTGCATCCACATCCGCCG
CTAAAGGAGACGCCACCCGATTTTGAAGACACAAGTCCACGAGCCGTCGGAGCTGCCAGCTTCTCTGTGCTGTCTCTTCCTTAATCCCATCAGGATTAGC
CTTCAGTGAGTCCACAAGTAACGCACTTAACTGCGATAGACGCTCACtatctgctgcgtctccagTATAGAAGGACAACAGCAAGCGGAGCAACTACACA
GTAGAAAGAATACACTAGTTAGATAGGTTCTACGCCTCGTATAAGGCTCAAAGGCCCCTCAAAATTCACCTCAAATAATGTTTCGTAAGGTAGAGGCATT
GTGGGAAGCTGCAGAATCGCCTTGAGCTTGGAAATGTCCCCCAGCTTCTGGTCGAATTCGGCTCTGTTCTGAGTCTGCAAGCGTCGCGCACTTAAACGAC
CGCGTGCAAACgcttggagctgcttggccGCTACATTTTCTTCCTTACGACGTCCACGGGCTTCTCGCTGCTCCCTTGCTAGCTGCAACACGCGGGCGCG
GTCGTCCCGACGGCCACCGCCACCCCCACGGGTCAGCTCGTTGTCGCGCAGGAACATCCGGGAATACGAGGAAATCTGAATCACGATTCttttttcaacc
aatcaaaatgtTTCAATTAAAAATGTATTTGATTCGTGTAAATTTCATTGAACCAATCAAAAGCACGATccacagcaacttcaatCACCTAGACAAACTT
GACAATTGCATAGAGANATGAGACCGCAACCAATCATCAGCACGGGTGTATCCATCGTGTGTGGGGCCGTGGCCTCCGCGTACGCCATCGTAGGTGCCAG
GatcagcatcgacagcaacacctgcGTGAAGTTGTCGAACGCCGCGTACTGCAGAGCAGGGAACACCAGACCCGACAGGAACACGCACGCACTGCCCTCC
CAACTGCGCGTGTACTTGTTCTTCGAGAAGCAGCTGTGTGTCTTGTACTTGTGCTTTCCCCACGTGATGCCCACAGGCTCCGCCAGTCCATCGCCAATGC
CCGTGATGAACACGAGGATGAACACCAGAGCGCCCTGCGCAGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGAGCAATGTTGCCCACGAT
GATCCACTTGAGCGTGTTGGGACGGTCCTCGGGACGGTCCAGCGAGttgaactgcagcatgaAGAACTTGGAGTGCTCACGGATAGGCTTGATGAGCACG
AGGAAGCCTAACATGGTGAAGAAGTCTCCCCAGGCGAGAGCGATAGGACCAGGGTAGTCCGCCTTAATCACCAGCGGCACCATGTAAGCAgcaaagtgct