Description :
From Genome Similarity Track
Location :
Scaffold_2765:868- 2697
Transcript NameFunction/comments
Phypl_g15368hypothetical protein PHYSODRAFT_512138
Phypl_g15369hypothetical protein PHYSODRAFT_325775

Sequence
1829 bases(100 bases per row)
AAGCTGGGATCGTGCCGGGAGTGTTCGACGCGAACGCGTTGTTCGATCTGGAACTGGCCGCAATCGCGAAGTCGACGCTAGCTCTGTTCGAGAAGCTAGC
TGCTCTGGTTGGAGTAGTCATACCAGCTGCGACGCTGCTAGCAACGCGTAGCGGATCCTCGCAGTacgcgtcggccacgttggATGCTGGATGAGACAGC
TCGATCGAGGTGAAGCGGATGACGCTAGGACTAGCTGGCGCCGCCCTGCTGGATACTcggaagaaggaggcgaagCCGGCCCCGGGCCAGGACACGCCAG
ATCGCATGCGGACGTTCTTCAACGCTGCGATGTCCCGATTCTTGAAGGAACAGCAAGGGGCCGAGATGCAACCACCACGTGAGCTGTAGGATCGgatgcc
accgccgcgtgAGACGCCAAAGTCGCCCGAGAAACCAAGACCGAGCGATGCACCAGACGTTGAGATGATGTCGATCGGATCGGATCATGATCCACCTCCG
GCGGACGAATACGATCGGATGACTTGAGTATCGGCAGGCCTCGACGTGCTGTGGTGGCGACCGCAGAAGCAACGACTGGGggcgccacgtcggccgcACG
AATCCGAGTGTCCGCGATCTCGGAACTGAAGGAGTTCTCTGGGAAAGACAACGATGAAGATCGCGCCAGAAGTTGGCTCGGCAAGGTCAAGTCGGCGTTC
ATCCGCGATCAGGCTCCAGACAGCGATAAATATTTGGTCTTCGGCGATCTGCTCACGGGATCAGCCCGTAACTGGTACCGGCAGCTGAGTCGGACGACGC
GAAGCAACTGGAAGAGTCTGCTCAATGATTTCCTGACCCAATATTGCGGACGTGGAGTGTCTGTCGCGAGACAGTACTACCACGCGAGGGAGCGATCCGA
GGAATCAGCGCTCGAGTATCTCCACTGACTGAGCGTTGCCGGAATGCGAGCGAAGCTCCCGCTGTTTGATAGGCGCGTATCCCTGGACGTCAATATCGCA
CACCACACCATAAGCGGGGATGGTAGCGCATTCCCACTCGCAATCATGATGTGTTCTCGCTTCTTCAGTACACAGATCAGCTGTTCTTGTTGATTTGTCG
TCAACTGAGGGTTTCTCACATTCGTAGCTTCGTAGTCGATAGTCGTGACGGAATTTTCAGTAAGATCAGGAAGGAACGTCAACTTCTTTGCGTAGTCTTC
CAAATCAATGTCATTAGCAGGGGGCTCGTAATAGTTCATAGTGTTCTCTATCGAGCGTTCATTTCCTTCGGTTGTCAGCACCCTGGCCACCGAAACATAT
GTTTTCTCAAGGGTGTCCATTTCTGCCATGGTCACCCCTGTGGCTTTGTCAGACTCGAATGAACGCTCGGTGGTGCGATCATCACCTTTTCAGCGGCCAG
AACTACTTGTGGGAACCTCAGCGAGGGTTCGCTTGCAATATTGGCCTGAACCGTGGTCGAGGCGTTGCCGTACGGACGCGAGTCTCCTGGGGGATCCCTA
TTTATCTCCGTGCTTTCGGCATCGTCACCGGAGTCCAAATGAACACTCGCTGCAGGGTTCTCCATCGTCATCTGGACCGACAGTACTTCGGGGAGGTCCA
GTGAGGGTTCATTCGCAATATCGGCTAGGCACGAGATTATTGTTGTGGTCGATGCAGTGTTGAACCCCAGTTGAGATTTCTGAAGTGACCTCTGTGTTCT
GCGCCGCATACTCTCGCTCTTGTTCACCGAGAACCTTCTCCCAACGCTGAGCACATGTCATCCGATTCGCTTCTCAACCTGGTGAGTCTCGGGTTGGGCG
AGCTTTCACCCCCCGAGGTAATCGATAAT