Description :
From Genome Similarity Track
Location :
Scaffold_2811:868- 2416
Transcript NameFunction/comments
Phyta_totarag14857hypothetical protein PHYSODRAFT_563428

Sequence
1548 bases(100 bases per row)
TTGATGGCCGGATCGACGGGGGTAGATGCCTGCAGGTAGCTGACGGCGTTCTCCAGGTCCTCCTGCACCCCCTTGTGCATGCCCAGGAACATACGCTCCG
CAATGTAGAACGCCGGGTTAATGATCACGGAGAATGCGATCGTAATGTGCAGCTGCATGAACAGGTAGGCCAGCACGACTGTGCCCCAGTTAGGCGCGAA
ACCCAGGTTGGTGAGGCCGGTCTCCGAGTCCGGATAGATCGTAAAGAGCAGGTTGCCCGAGATCTGGCAACCCACAGCCGAGTACGCCGTGCTGGCCAGG
ACCAGGAACAGGATGGAGATGACACCGACAGTGACGCCCACGACGCGCGGCATGCGCTTGGGGTCGCTgtgttggcgctggatgtCGGGGATCACAATAC
CGGCGCCGTAGGCGAGCGACAGGTTGCCGAAGCAGCCGGCGACTTGCGAAAACGAGAGATCGGGCGTCGGCACGCTCGGGTGGCCGGCGAGACCGTGCAT
GACCACAGCCACGCCGAGGATGTCGGCAACGATCGTGCCCAAGCAGCCGGCGAAGGcggcaccagctccttcctTCAGGGTGGGGACCAAGCACACGGGT
AGCACCATGAGCGCCATGAGGATGATCCACGTGGTCTGGCTGAAGGCTTCCGGGAAGAGACCGTCAAGCAGCGAGCCACCGAGCACCAGGAAGACACACG
GAATGAGCAGGCACGAGCCCATTTGGGAGATGATACACAGCCAGCGACCGGTCTGGCCCATGCACCACTCACCGAGGTCTCCGAACGTCTTGACGGACTT
GGGTGCGAGCAGCATGACCTTGGACATGGTAATGGATGCGTAGATATTGGCAAAGGCCATGAAGGCCATGGCGATCACGGCGAGGTAGGGGCCGGCGCGC
GAGAAGTTGCCGGGCATACCAAGAGTTCCAACGCCGTAGATGCAGCAAAAGAGGTTGAAGGCTGACTTGGCGTCCTCCGCAGTGAAGAAGGGTTCCTTAG
CCATAGTCGTCGTTGAGGTGCAACGCTAGGACGAAAGAGGAGTGAGCGCGCTGTTGGCCAGGGGGTTGAGCTGGAGGCAGTCAAATTGGAAATGATTGAA
GTGGGGCGGAGATGCCGGGCAGGCAGGtgcacaagcacaaacaccGTTAGGTAAGTTACTGAGTAACCAGTCGGGAGCCTTTAGGCCTTACGTTGTAGCG
GATAGGCTGATTTCGGAATCGCCGTTTGTTGGCGgcagctgtacatgtagcagttGAACACTTACATCAAGATTGTGCGGGAAAGGATGCGAGCTAAGTA
AGATACGGCCTGATTAAATAATTAATCCCGCAGATCGACCACACGTCAACATGCGAGCGTACGGGCGTCCGTCCACCTGCATGTTGCCTTCACTCTGAGA
GTACCTTCTTGGCGCACCACTGTTCAGCGGGAGTTTTTATTCTACCCGCTAAAatcaatgctgctgcagtctaTTAATACACGTGTGCCGAGTTTCAATC
CTTTGGCTCACCGGGGTGCAAAGGGCTCATGCAGGTTGGGGCTGCAAA