Description :
From Genome Similarity Track
Location :
Scaffold_99:86792- 92197
Sequence
5405 bases(100 bases per row)
TCTCGCACAGCCGAACCCACGATTCTGCCTGGATTATAATGTGCGTCGATATAAGATCGGCGTCCTAGCACAGACGGGGTCCCAGGATCCCCTGGCTCCC
CTGCTTCGAATGGACCCACTTCCGTATGATCTTCCCCGGATCCACCCTTTTCGGGCTCCGGTATTCGGGTAAATCCATAGAGAGCGTTATCGATCAGGCG
TTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTTCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCC
GTCATAGTCACCACCCAGAAAAACCACCGGCCATGTCAAGAGAACAGTACCAGAGCACTTTATCCAAATCTTCCAATCGCTCATTGATTAGAGGCATTGG
ATACACCATCGGTCGGGTCGGGCCGTTAACTAGACGGTAATCAATACACAGACGTATATCCACTCCATTCTTTTTAACGATGATTACCACCGGAGATGCC
CACGGGGACGTTGAGAAACTGATGCTCTTGGCTTGCAGCACGCCCTTAATCAGATCCGATAGTTTTCTCGGAACTGAGGTGCCACCTTCCTCACCCTTTG
CGCGATCGGTTTCGCGTTGCCGACATCGATGTCACATTTGACTCCGCGTGCAGCTGGTGGTAATGCATTTCTCTTTCCAATCAGCAGATGTCGGCTTTCC
CAGATCTTCTGACGTAGCCGATCCACTTCCGCGGGTTCGTTCGCCCCCGATTCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTC
CGGGATCACCGCCATGCCTTCTCCGATATCCTCAGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGATATTCATTGT
TGGATCCATGCACTGCGACTCTCTTTCATCTGTCCGTCCTTCTGTCTTCGTGGGATCAGATACCCTGGTATCGGGAAAGTCACCTGTTGGATCGACTTGA
TCCTTTAGCGAGTTTAAACGCGACGGTTCTTGTTTGACTAGCATTGCCGCTCTCGACAAGGATCCAGGCACTTTGTCCCATGAAAAGCTAGTATCCACTT
GTGGGTTAGCAGGATCTGGCAACCCGGCTTCCGTTCTCTGCGATGCTTCATCCACCGACCCTGAGTTATCTAGGGACCGGCTCTGGGGATCCTCCCCGGT
CTTGGATCCAACCTCAATCGCTTGGATCTCAATCCGACGATCCCTCTGCAGGATCTTTCGCGGAGTTAGGTATGAAGGCCGATCTACCAAGGGGCCAGTT
GGCTCCGCCGGGAGCTCCCCCTCCCCGAGAGATTCGATCTTGGTAGTCGCCTCGTGCGCCAGATTCTGCCATTCTCGGTAACGACGGGATCCCACTGACA
CATATCCAGGTCGCCTAGGGATACCATCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGCCCAGTAATAGTCTCTTCGTCGCCTCGTACGCCAGATT
CTGCCATTCTCGGTAGCGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCC
AGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGGTGGGCACCCATTTCTCTCCACAATTTCTCA
TGGTTCACCCACTTTAACCGATCTGGCAGTTCCCAGGTCTCTCCGGGCTCGATCCAGGTCGTCTTATTCGCCCTTATGATCGTCAGCTTCGCCCCGTACA
GCAGTCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCAGCTGGTACCATAAAGTCCATTCCGAGG
ATGGCGTCTTGACCAGCAAGATCTCCGACCCAAATATCGAACCAGTACACCAAACAACCTGCCAACGTGACCTTGATTCGCGTTCTCCCATTCGTACGGT
ATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCACCCACTGGGCATCCAAACTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGC
ACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCA
CGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATATAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCT
TGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAA
CTCGTCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCTTGCTACCTGGATCTAGC
GATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCAC
TTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCA
CACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCC
GGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGTGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGA
GTTGTCTCCGACCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCAGAGTCCGAACCGTCGGATCCTGATTCAGTT
CCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCAACCGCCGCCTTCTTCT
GGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGTTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCCCC
CACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGT
AGGTGTTCTAGCGGGGATTCATCCGATCTGGGGCGAGCGGGGTAGTATTGTCGTGCCACCGACACTTTCAATCCACAGTACTGGGTCTGGAAACTGCGCA
GCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGC
ATCCGACGCTTGATCTCTCATGAGGGCCAACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCC
GATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGAT
CATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGG
CGCTCTCATACCATGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTTGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGG
TCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCGTGGCTGGATT
GTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCC
GGAGGGTCCTAATGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGTGACCTCGGCGA
CGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCG
AAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTG
GTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGTATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATA
CACAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTT
TCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTT
TCTTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGTGGTCCCCGAGGGGACCTGGGAGGATAGAGAGGTTTTTTTTCTAGATCTGGATCCG
GATCCACCTCCTTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGA
CGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGCCTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTG
TAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGC
TGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGA
CGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTA
GATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAA
AGTTG