Description :
From Genome Similarity Track
Location :
Scaffold_60:86727- 115084
Transcript NameFunction/comments
Phyci_93915hypothetical protein
Phyci_229455hypothetical protein
Phyci_229339Hypothetical protein
Phyci_67212Hypothetical protein
Phyci_105343Hypothetical protein
Phyci_93916peroxidase-like protein
Phyci_229492peroxidase-like protein
Phyci_93919Hypothetical protein
Phyci_229379Hypothetical protein
Phyci_81739Hypothetical protein
Phyci_229464Hypothetical protein
Phyci_9218Hypothetical protein
Phyci_9219Hypothetical protein
Phyci_313133conserved hypothetical protein
Phyci_229375Hypothetical protein

Sequence
28357 bases(100 bases per row)
CGAGCTCAAGCATATAGTCGAACCGGGCCATGTTCCTCAAGCGATTGGTCAACTTGTGAGCTGCAGCATGAAGGCGCCTCTCAACTGCTATCCGCTGAGT
TTGTTGACGGATTTAAACGACCACTGGCATTTCTCTTGGTTCAGCGACATGCACGTGTTACGTTGCAGTATCCAAAGAACGCGTTCAGATTTATCGAGGC
AGCCGTACTGAGACGAACGGAGTCTGCCCCACTTCCTCCGTCATTCATTCCTGGACCTTTCAAGACAATCAAGGTTGATGACTTCTTGCCCCAGCCGGAT
GACGATCGTGCAGAGGAGATGATGGAGCGATACGAGTTGATGGCAGATGAGGTGGAACCAGAGTTTCTCATGGCGAGGCGTATGGAGTATGCGCAACACG
TGGTGCAATCGATGCCCATGTATGCTCACATGTATGCGTAAATTCTTAAAATGAAGTATTCTCTGCTGCTGCTCCTCATGTTGTCACGTCGCTCGTTGTG
CTCGAGATGCTGTTGTGCTGCTGATTGATGGTTAAAAAAATACTGAGGACACACCGTCTGACGATTCTCTCTGATAGCCTTGTCTAATGTTAATATCGTG
TGTTTGAAGGAAAAAAAATCTTGTCCAAACTCCTTTCGATCAACTGAACAATTTTCCATCCtgataaatataaaattagtaatatagtaacatggcgtac
tctcctgaacaataccacgctaacaaggatcgcatcaaggcagcgcagaagcgctactaccaacgcacccgcgaagctcgtttgtcgtatcagaaggggt
acgacgacaagaatagagagcagattcgagctcgaaaacggaaggcagaaacgaatttaacgaaaaggtaaaaacgtacttaccgaggaaaccgaactta
gctaattaattttttttagatgaaaaaagtcgccagtgatataaagtcgatcctgatacaagatctcaatattataaagtcaaaccacaaaaaataatat
aggttgatggatcgttcctgatgacctggggaaagcacataggtaagacgatcaaacagatctattcctttgattgtggatatatcgattggttgaagaa
gaatgaatttgttaatgagaagatgcctaagctaaaggaggctctcaatgagttTGCTTAAGTTTTGATAAATCGGAGGCAACTTATTCACGAATACTCT
CACCAAAGTGATGACTTCAGTGATCACTATTGCGTATATCGAAAGGTTATGAAAGATGTGCGACTACAGCGTCTATTTTTTTGATAAAAAAATACATTGT
GAATCGGTCCCTTACTACCATTTACTATAGTCCGGACCCCACCAGCCAAGATCTTCGCATGGTGCTTATCCACTTGGAATGCTTTTCTTTATTACAGTGT
TTAGCGAAGTTCCATCTCTCCATCGATGATCCACATAAGCAAGTGATCCTTTCATTCATTGGAGCTGAAATTATTTTCTTCATCATATCTTCACCAACTT
CTGGTGAATGCacttttatcgtagggaatttcgaaagtggatgcttacagcaacgctcatgcaatggtctcgccgtgcacttgaatccactgtctaagat
ataattgcacatggttattactagtagtatttattatatacttactagatttttgtcttaagatcagctaacttctatcatcctttataccttctttgga
tgtacacccattgttgctgtgtgcggtgctcggaggtgtggaggagacctctttcgcaccaggcgctacttagcggcggtgtcgacgttttcagcagctg
GTGGTCAGGAAGGTGCAGAGCAGTGCTCGTTGGAAACTGGCGGTGATATGTGCCGGACTCGACTACACTACCCAGTCCCTCTCTTCAGGAATCTGCCACT
GCAGCTGGTGCAAATTCCTCACGGTCTGCAAAAGCGTAAAAGCGTGAGTCACGGCAATGTGGGTTTGTCTCCCGTGGAGAAGTCAAGGAAGCGAGTTTGC
ACCGATACTGGAACTTTTGTAAAGCTGGTAGCAAGACTCGCGAAAATAGGCCCCTCCACATCTGCAGACGAAAAGGCCGTCGAAAGTTTACCGACTGCGT
CGAAGTCGAAGGAGTCAAACGGCAACCATGGAGGTGACATATTAACCGATGGTTGGTGTTGTCGCTCGTGTGTTCGAATATGGGCTTGTAAGATGACAAA
TCGTTTAGGAAATCTGAGTGGTGAAGTGAACAAGCTACGTGGAGCAGTGAAGACGGGTGTGTGTAGTGCCACCCCAGATGTACCAGTGAGCAGTACAGAT
TCTAGTGCCACAATTACACCGCAAGAGCAGACAACCACTAGCGTTACAACTTTGGATACCCTCCCTGAGCAAGATCCGGGGAAATTATCTCTTATGGAAA
ACTACAACCATGTGAACGGCCAAATTATCATCAACGAAAAAGCGCTGGAAGACTCAATTGCATACCTCAACCAGATTTCTGCTAATGGTGGATTGAGCGA
CTTGGACCAGATTGACGAGTTACGTGTCAATCTCAACCTCGCCAAGAGTAAGCGTGATAAGGCTGTTGCTGTCATCATAGCTCATCGATGGAGTGCTCGA
CGGAACGAATTCCGACTTATATTGGAGAATGTGACTGTGAAAAGTAAACCCGATGCTGAAAAGGTGTTTCACGAGGAGTGCGCGGACATCGCAGCGCAGT
TGGTTGAGAAAGATCACGCGATTTCGGAGTTAAAAATGCGGGCCGAACGAATAGAATCCGGGTAAAGATCCTGAGGGGTTTTCCAGGTTAGATGCCGAGC
TGGCTGCGAAGATTCTTCTCGAGCGCGAACGTGACGAGCTCTTCATGCGCTTACTACGGTCGAGTCGACGAATCTACTTGCTCGCGAAGGACACGTTTGT
GCTGAAAACGCAGCTATTGTAGAAATACCTCGCCGTTTTCTTGGTAATTATTCGAAGAATGCTATATGTTGTGTGGCGAGTATATCCCCAATCTCACAAC
TGTGTTAGGTCCATCACTTTTCCATACGGAGGATAATCTGTGTTGGACTCGGCAGTTGGAAGATCTATGACTCGGCAGATGGAAGAGAAGTTTTCCAATC
AGTCACGCGTCTCTCTCTGATTTTGTAACCGACTGCAAAAAAGAAGACGTGGGATCAGGCGGGGTTTACTATTGCAGGCAACCCAGACCGCCTGCAAAGT
CTTCGTGAACTGGCCCATTGCATGCTGTATGTAGTCTAACTAAGAATGTTTACTTAGGATCGAGAGATTTAGCTCAAACTGCTGTCTTGAACTTCTCAAG
AGATTCGGGTGGTAAGATTGTGAGAAAAAAAAACAGGTCACCCATTCGGCCAGTCCAATTTTCCAATTTTTTCTGCGCCAACCGCGCTCGACTGGTGGCG
CAACACGCATAGCCTCACTTTCAAAACAGCTCGTCAAGGAGGACCCAAGTGAGCCACGCGATGGAGGAGGCGCTACTGACCACCAACGGCAGTTCGCCTC
TTGAAGCCAAGACACCAATAGCATCATCGTTTCGAGTGGAGGAGAAAGAGAGAACCTGCACCAGGTGTGGCAAAGTTCTGGCCACTCGATTGGCGCTCCA
TAAACACCTCAACAAAGTCTTCCTGTGCGACCGGAAGGGCGAGCGCAGACACAAGGGCGAAATGCGGCAGCTGAACGGCATTCATCGCTGCGAAAAGTGT
GGAAAGAACTTCAGCAGTTCTGCTAATCTCCGCTATCACTGGTCGAAGGTCAACCCATGTGACTCGCAGCAGTCAGGTGAGCAACACAAAAAGATCCCGG
CCAAGAAGAAAGACAAAACCAAGCAATTTCAAAAGTGCCCCAAGTGCAAAGCTACGTTCTCATGTTCGCAGAATCTCCGCTTACATTTGAGCCGGCTGAT
CCCGTGTGACAACTCGGAGCCCAAACAACACGACCCCGGCAACAAGACTTGCACGAAGTGCAATGTCACGTTTACCAGTGCACAAAGTCTTCGTCTTCAT
TTGACTCGTACCATTCCATGTGACGCACAACAGCGATCAGAAGGAGATAAACTCAAGTGCGAAAGCTGTCCCAACTGCCGCAAAAAGTTCGCTAGCGAGT
GGAGCCTCAACATTCATTTGGGTCAACGAAATTGCGATGGAAAACAGTCGTCCACAACGTGAACAAGGTGGGTAAGACTCGTGATCTCTCAAGACCAGAC
AAAGGACCGCCTGCCAAGGAGTCACTCGACGAATATTTGCTGATGGCTTCTCATCGCAACAAGGAATCAAAACCCAACAAAGAGCAACATCGAATTAACG
ATGCGCCGTTGGCTATCCACGCTCCATCCACACATCAACCAAAGCGGCAACATCAATGCCACTCGAGTGACAAGTTTGCTAAACACATTGGTACCTCCAA
AGCGCTTTCTTCGAAACGAAAAAAAGATGACGAGGGGAGGGATGATATATCTCCTGTGTGCGAGCCTAATAAACGAGTTCGTAGGGAACCTGGGTCATTT
GCTGATCTGGCAGCACGAGCAAGCAAGACAAATACCTCAACTCAACCTGGAACCAGTGGTTTGCAGAATACTAAGCATGGAGGTAACATACTGACGGATG
GGTGTTGCTGCCGCGAGTGTGTCCGGACCTGGACCCGAACCATGATGAATCGTTTCAATCGCGTGAGTGATGAAGTGACGAGCCTACGGGAGCAGCTACA
ACGACATGGTAAATCGACCAATCTGACATCTGAAATGGCTATTGTGAACAATCCTACGTCATACCATGTTACAACTGTATCCAGTCCAAAGGTGAAAAAA
GAATCGAACCTTTTGGGTCATAGTGCTACAAAAACAACTATAAATTGTTCTGGTAAAGATCGTGCCAGCAAAACGAAAGCGGAGCCTTCGACGAGTGCAC
CACCATCTGGCGCAGCGAACGCGATATTGGTGAAAGATACTGTGAAACTGAGTTTGACTGAGAACTACAACCACTTGAATGATCAAATCATCACGAATGA
GAGAGCGCTCGAGGATTCCGCTGCCTACCTGAAGGAAATGTCAGGACATGATGATACTGATACTTCGGAATTACGCTCTCAGCTTGATGAGCTTAAGGTC
TACATTGACGTCGAGAAGGGGAAGCGGGACGAAGTAGCTGCAGCGATTATTGATCAGCGGTGGGCGTCTAAGCGAAACGAGTTCCGACTCTTATTGGAGA
ATATGACGGTTAAAAGCAAGCCGAATGCTGAGAAAGCTTTTCACGAAGAATGCGCGGAGATCGCGAGTCAATTGGAAGAAAAGAACAAAGTGCTTGCAAA
GTTGGGTGGGCTGATCGGCGCAGCCGGTGTGAACAGTGAGAAGCTAGCCAGTATGAAAACTGGTATCGGAATTCCGAAGTATGCTGTCGAGAAAACAGCT
AAGAGCTTCCTCGAGCGCCAACGCGACGACATTTTCATGTGTCTACTACGATCCAGCCCTCGTATTTATGTGCTGACGAAGGAGAAACTAGACGGTACTA
TGAACTAGGGAAAAGTATCGGTGGTTGGTAAATGGAGAAGTAAGTATTCATTTTACAATTTGCGGTCTGCTGTTGTACTACCAAGTTCTGTTCAAGCGTA
TGCCAACAGCTTGGCCAAGACCGATCGCAAATACGACAGGCTTACTGGCTCAGCGGACGCAACGTAGTTGTCCGGGATACGCTCATCCCATACAAATGAG
TGTGCAGCTTCCACCGTCACGGACTCGTTCACATTGCCACCGCAGCCGACGATAAACACTGCAGCCTCCAGGTACGCGAACGTGGTCTGGTTGGCGCCAA
AGACGCACTCGGGGTTGTTGGCTCGGCACTCAGCCTGACGGTCTCGGCGAGTCTCGGCGACTTCGGGCACGCCGAGGGTCTTGCCGTCACGCGAACGGCT
GAGCAAGTTCTCAACCAGAGTCGCGTTGATGTTGATCGGGTCACCGCCGAAGTACGCGTCGTCGTGCACCAGAGACGCGTCGTGCTCCAGCACGTTGTGG
CGTGAGATTATGTCGAGCGAGAACGTGGCCGGCACCTGGTTCAGCAGCGTCTGAGTCAGGTTGCTGTCGAAGTTGAACACGGACATGAGGGCGGCACCCA
GGTTCTCATGGGTGACGTTCTTGCCGCTGCGCGGGATGTGGCCGTGATTGGCGAGCGCGTTGAGGCCGGGGCATGGCGACCGACGGAACGGAACGGGCGA
GGTGGAGTCGGCATATCCCGTGACTTCGTCGCTTGAGGGGCGGTAGAAGTCGCCGACCTGGAGAGCGTCGATGGACACTTGCGCGTTCTGGCCGTTGTCA
ACATACCCGGCAGCGACGGAGGCGACAGCCAAGGCGATGAACGATACCATGGAATCGAGGGAGTAGCGACGGTGGAGAGGAGTGTACGCAGTGAAGTTTG
ACAGCGATGGAAAATTGGAAAATGAAATCCTAGTTGACGAGTGTCCGAATCACCGGGTAATCAGAAAATTCACAATCACCTCGATCATTTTTCACTCAAT
GGTGTCTCTTGTCGGATGGTATCAAGTAATGAATCACCTATTTTGAAGAAAAAACTTGTAGCCCCGCTAGAACAGGGTGGCAGCTCTTGAATTCGACCAC
TTCGAAGTATAACATGTGTACTCGCTACAGGTTTCTTCCTGACTTTCCCTCGAGGAATTCCGCCAAGAGATGCTCAATACTTAAGTAAGAGCAGCAGCAG
CTCTCTTGCACCATCGGTATCATAGGCGATCCCTGTTTCTCTTTACCCAGCATTGTACTTTggaaaataaatattatctgttgttctccccctgctcgtc
ggttgggcctccacagtcactgctcgcctgttgcaagcactatttatctgttgcatgtcgacagagaatcagcactgcatatctgttgacctgaaaacct
gttatcgaaaagcataccatgagcacaatgtagtagatatacagtatatcttatgtattttgtcaccgtgttcggatgaagtatatcatatacttcatcc
gaaaaaatgccagctaaaacatttaagtagtggtcagtgaggacgagggtggctgtgactagcacatgtacgagaataaacatcagggcatgcacagctc
gcaaaaagaacagacgcacacgccaatacatgttggtaggacgaaacttaacagactagcccactccgcactcccacgtttactggccaacaagcagtgt
ttcctggagtccatctacgacttggtctaggtaaacaacgaaataacatatgaaatttaccaggtaacaggaaagcatacNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNacacaaaaaaacacatttg
cacaacacacatttaaacaaaatccatttgacagaacgcagcggcaccagcgcactgggcggggcaccacgcggacctcgaccgcgccgccgcccgaggg
agtgatggcctaaagggcggcgcggcgaagcagagcagcaggggccagcgctgctacgactagcgtgccgaccacgaccgcgccgacgcaggaggggtga
tggcctgaagggcggcgcggtgaaacagagcagcagggccagcgccagtgctaaagagcggcaatcaaatctgtacgtacaacaagggggagggggctga
gcatggattgaactactaactggttttgaattggttttaaatgtgaactaggaattgcctttgagactgtcgctcagcgcattgagtgtaagcttgctct
gtattcggtgtgcttcgacagtacagacggattgcttgcgttcgtgttaatcggaggatttgctcacagcttatgggagggatgcacttcacgcagcagc
acatcatcttgtaggacgactacccagaggtacagcagcaattccaaaaatcctccagttgatatgtgcggtgttgactgttttacctatgttgtcatgt
agttaaatggaaacgcttcgcgttgcaaactatcatgaggtgtaagagcagctcgatctaaacagaatgagcggcggtccgggggaaccccagcaaggga
gcgcatggcgtcccgaggcaaatccgccaggtaatatccctccacagcgccagcattccagcgccccaaccttctaatctgtgactctgttgctccagct
agttcagccattcgggatccagatcgtcgggtagcgtgggtcttagcttttgagtgcatactgagggcagagaaagatttacggtagcgccgtaatgtgc
tcggtatgtaattgcttttgttgatttttttcctgccttgagaacttaaattatacgacagtgcaggctcgagaaaattagaaacagctcccttaggcgc
gtatgcgcgggtcgtgtcggcaggccttgcctcgcgacagcgatctagcgttgcgttaccgtcctcttcgagctcaacttgcaaccctggtggttccatg
gcaccaaacacaatttacgatgtggactattttttgatatcaccgaagagctgcctgcagggagggacgccgtccccattctatagtgcattcaagtaca
gctacacctaaccttagggagataacctctcagtaGCGTAGTAACCTTGAATAGAGAGTTTTTTTATTGTAGCATCTTATCTTATTCATTTTTTTACCAC
GAAGTAGGCCAAACATTATCTATTTTACTTGATCAGCTCCAGTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCGAAGTCGCCGAGACTCGCCGAGACCGTCAGGCTGAGTGCCGAGCCAACAACCCCGAGTGCGTCT
TTGGCGCCAACCAGACCACGTTCGCGTACCTGGAGGCTGCAGTGTTTATCGTCGGCTGCGGTGGCAATGTGAACGAGTCCGTGACGGTGGAAGCTGCACA
CTCATTTGTATGGGATGAGCGTATCCCGGACAACTACGTTGCGTCCGCTGAGCCAGTAAGCCTGCCGTATATGCGATCGGTCTTGGCCAAGCTGTTGGCG
TACGCTTAAACCTCTAGCATCTGCAGAAGCATGGAATCCATGCGATAGAGAAACGTTGAATTGTAATATGAACAACGCTTCCCTTATCAACCACTGAACC
GCGTTCCAAGTGAGTTTTAGATCTGACAGCATGGTCCAGCATACTGACGGACGCGCTATCGATAGTGTGTAGGAAATCTACCAGAAACTGGTAAAAGAGG
TGTCAAACCTACAAATTTGAACCGCGAACCGTCCGGAGGCGAAAGAAGAACGAATCTGGAAGCAACGTCGGCTATGCTGATATCAAAAGACAATAGTCGA
CAAGACTTCTCCAGGTAAATATCGTTTCATCAAGCAGAGTGAAGATAGAACCTTCAAGAAGCAGCTAGCATCGGAGCAAGAAGTACAACCACTTGAACAA
TCAAAGTATCACGAAATGTTCGTGAGGGTTCAGCTACTCCGAAAGCCTGTGAAAATTTGCTGTGGGAAACTAGGCACACCAACAAGACTTTCGTGTACCA
GCCAATCGTATTCAAAGTTTTCTTCCAACACTGAATACTTTACCAACTTTCGGATCTGTGTCACTGTGCAAGAAGCCTGTCATGACTTCTTCACGCTGAG
TCGCGAGCTGCTCTTTTGCTGCTTGGCCAATCTCTTCGACAGTTTTCGTAATGCATCGAATCGAAAAACTTTGTATGCTTCAACGACATCTGGTGGTGTC
TCCGTTGCCCATTGAAGCTGCTCTTTTAAATGTTTTTCGTGGGTTTCCAGCGCGTTGTCTTTTTCCACGATCTGCGATGAAATAGTAACTTCTCGTGGCC
AGCGCTACTCGCATGACCTTCAGACGGTTCTTTGGTTACAAGAAGAAGCAAAGCTTCCTCTCGTACTTTCCATCCATTGCACATAAGTCAGCTAAAGCTG
TAGTTTCGTTTTCGTTGCTGTTTACTTCAGGTATTGAGTAGGGGACAATAGCAGTGTCGGTATGCCCACGTTCAGTCGAAGATGCAAAATGGTCTTCACG
CCTGTTCACTTGATGTCTTGAACTCTGCGTTGATGTGCTAACAGCGGCGTCAGTCTAGTCGCTCACACCCCTGCCCTACCGTTTTCACGGTTATTCTCGT
TTGCACTGGTGAGGATCAACGCTGGGCCATTTTTGAAATGATGGTAACCTCAGCCTTGGCGACATGATCTTCTGTAGGTGGATGCGGCGATTTTGTAGGA
GAGGAATTGTCAGGGTCTCGGTGACGTCGTGGCGAGATCTCATTACGGTTTGGGACATTCGTGTGCTTCACGAGCGTTCTCCTCGTCTTTTGGCGGAGAC
GCGGAACGTGTTCGTAATTGAGATGACTCGGCACTATACGGTGAGCTTTTCCTATGGCTCCATGCTGGGCGAACTGATGGCGATATATACGTTCGTTCAA
CGGCTTAAAGCGCAGCGACAGCGATGCTGATGAAGCCACCGGCCGAACGCTTGTTCGTATTTTCCCCTGGAAACAGAGGCACTGGAATCTTGGTCTTTCA
TCAGGTCCGCGCTGATTGCGAACCCCGTTGGCAGATTCACTTCTTGAAGACGATCCTCCACGGAAACCACGCGTGATGCCAGTATCTCAGTTCGACTTCT
TGATCGGGGTGACTCGCTGGAACAATGGGTTGCTGGGGACGCTGATCGGTGGCGAGCTGAACGCGGGGGCATTCGGCAGGAGCTAAGGGGCCGTCACAAT
TGTCTCGCAGCCTTGAGTTCGAGCGTGGACGTCGTTTCCTTGCCAGTTTACCGGCGCTCGCGTTTCAAAGGCGTTGTATGCCTCCCGTCTTCAATCGGAT
AAGCGGGAGACCTCCCTCAAGACTCACTTCTGTCATGCTCAGTGGATCTGGGACGCCTCAAACGCTTCCTTTTTTGTGAAAGCGAGCGTCGGCCAAGCCC
GTCCTATTCCACATCAAAAGTCGGAGCTTGCGCTCTCTTTTCGCGTGGCAGTGCAGCGATTCCAAACTTTCGTGACGATCTGCCAACCATTGCTCGAACT
TGTGGTTGTACTGCTCTACAGTCTCGTCAGGGTAGAGAGGCACGGGGATGGCCTCGGACGGCGGGAGGAGGGTGTTCGAGTCGAGAGCGAATAAGGCGCT
CTTGTCGGAATTCCTCCACCGCCAGCATCCGTGTGGAAAGGAAGCCCGTCCCAGGACTGGCTACAGCACTCGGCTTCGTAGCGGCTGGCTGTGACGAAGC
CGGAGTCTGCCGAGCACTGGGCAAGACGTTCGCCGTGAGGCGCCGGAAGTAGGACCGATACTGTCGCCTCCGTGGCCTTTCCTTGGGCGCCAACGTGTCA
GCATCCATTGTGCCACTCGAAGCATGAGTCCGCGACAACATGCATGGcctaagtcagcaaaaacccgccaaacaaaccagctaggcgtaattttgcagtg
ctacgtacgaagacagcgaactgtggcgacaccacattgcgcagatccagcttcagcgacaccttcttgagcccatGCACCAGTGTCTCCACCTGTCTGC
GGAGGACGCCCGACCCACGAGCAGCTCAACAAGATGCGCTGGGAATGGGTCCAGAAGAGTGGTGGAATGGGACCTTTTTGAATGGGACCTGTTGCAAAAT
TATAGATACCGGTATAGTACTGGTATTTCAATACCAAAACTTTAATAATTGAGACTACTCTAAATCTTCGTTCTTAAAACTGGACGGTTCTAAAAGCGGT
TCACGAAAATGGAGACCTGCTTTCGCTGCAATTTATTCTCATGAAGATGCAAATGTCCCCAAAGCGTCTTGGACCAACTTCCGCGCTTTGTCGTCTGCCT
GCATCAGGCTTTGTAGGGCTTTCTCAAATTCATCTTCCAGGTGCGCTTTGTCCGCTCGCTTCTTGGACAAAACAGCAGACAGCGCCCGCAATTTCTTGAA
CCGTAGAGCTCTGCCTGCCCCCGTGGCTGCAGGCGGCAACGAGCGCACCAACTGGGCTTGGTCGTCTCGTTGCTTCTCGAGTGTTTTCAACTCCTTGGCT
TTTTCCTCATTTTGTTCCAAAAGAGTTGCCAAGCCCTCGGCCTTCGCACCTTTGCCACCAGCAAACTCTTCTTCTAACACAGACACAAGCCCTTCCTGGC
GCCCAGCCCAGTTGGAGACTATCAAAGCGGCTAGAACAGCGGTACGCTTTTTCTTCGCGTGGTTGATTGAGTTGAAGAGTTCCAAGCTTTGAACTCCCCG
GACTTGGCATTCCTCGATCTCTGCGGAGCAAGCGACCGCATTATCCCCCGCAGCCTCGCTCATGATTATTTGTTGGTCCAAGCGATCGTACATCTGAGCC
AGCCGCAATTTTTCTTCACTGCTAACCTGGCAATGAAAGGCGAGCTCCAAGTCATAAACAACCGCGTCGTCAGCTGCATAAAGACACCCCTTTGAACGCT
TCTGGTGTCTCGGTAACGGTGAAAGAGATTCAGCTTCATCATGCCAGGAAACATCCTCGCCTTGAGTTATCGCGCCGGATTGAAGCGCATCATCATGTAT
CTCGTCCGATATCGAGATGCTCGGTGTAGAATGGGGTGGCGAATCTGCGTTGCACTCAGGCTGTTCCGGGGACACTGTGTGTGCCGATGACAAGTCGTCG
TGGTGGACCAACGAAGCCGCCACCCTGTCATCAGGCTGCAAAAAAGTACGTGACGATCCCCAGTCAGAGGAGCCATTGCAATGGAGGTCTCCACCTCCAT
CAGGATGATCTTCACGCGGTCGCGACAGCGATCTTGCCAAACTGCTTCGCTCCGTCTCATCATTGGAAGAAGAATTTATGGCGCTTGCAGGCTCTGAACG
TTCGGTGATACTTTCTCCCGCACGATATTCTGGACACGACGCTCTGTCATCCCTCGTGCACCCGTTGCGCCGCATACGTTTGCTGCTAGGCCCAGGGCCA
TAGTGCGATAATAACTCTTCCATGTCGTGCGTCCTCGGAACTACCTTGTTTCTCAGCGTCACGGTGTTGCACGTGCCAGCTCGTTTGTGTGCAAAGGAGA
ACCAGAACCCGCGCTCTCGACTCGGGTCGTTGCGCAGTGTCTCAAAGGTCTCGTTCCTCTGCAACAGCCACATCTCGAACTCCTTCGAGTACTCCTGCAA
AGTCTCGCCGCAGTGCAAAGGCACCGGAATCTCTCTGAAAGCTTGCACCGACGACTTGTTGTTCCACCGTTCTAGCACTTCGCACCGCAGGTCCTCCACC
GTCGTGATACGCTTGGCCAGCAGCTGCTGGCGGTCTCTGGGAGGCGAAGCAAAGTCGAACGCTGGTCGGCGGCTCATGTTAGCAAGAACAAACACACCGT
TAGAAATCGCAGTCCATCGAACGACATTCGTGCAACAGTCGGATTGATCGACAATGAGAAGTTCGCTTCAAAGATTTTCTTCATTTTTATTAAAAATAAG
AGAGCATCGAAGCGAACTTCTGATAAAAAAAAAGCAAAAACTTAAATGGAAACGGATGTTGAAAGGCTGTTACATGCATCACGAATTTCTGTTGTGTTTC
ACGACAACGACTTGCCCACCAGCTTTCGGACGTCTGCATCACCTCGCAAGAAACACTTGAACATTTGCTGGCATTCTTCCTCAAGCTGCTCCTTCGCTTT
TCTCGCCTTGGCCAGCCTATCACACAGTTCTCGGAACTTCTTGCCTCGTAGCGCTTTCCCAGCCTCCGTGACAGAAGGCGGTAATGCGTTCAACAGTGTA
GCTTGGTCGTTCATCTGCGCCTCCAAACATTCCATATCCTCGGCATTCTTCTCGATCTGGGCAAAAATTGTCGCTAATTCTTCGTGCTTTACACTGGTCT
TTCGCCCAGGCGGTGATGAATCTTCTTCTAAGAGCGACATCAATGACCCCTCCTCACCGGTCCAGCAACCGTTAATTAACGCAGCTAGCGCAGCAGAGCG
CTGCTCCTTTTTCTGGTTGATCGCGACGACGAGCTCCATAATCTCCCTTTGGTTTTCCATGGATTGCACTTCGTCCACTTCTTTGATTGCCTTCACGAAC
TCAAGGGCATCGTTGATCGCTGTCTCATTCGTCGTGATCAAGTGGTTCAGTTGAGTGTATTCGTTGATCAGCTGCCGCTTTTCCGAACCGAGTTCCATGA
GAAAGCGTACGGGTGACGCAGTGACCGCAGCACGCGACAGTGGAGATTTCGTACCAGCTTCGAGACTTTCACCGTTGGTTCGAGTGACGTCTTTACTTTC
GTATGGAGCAATGGTCGCTGTCGCATCGCCGCCAGCGTCTGAACACAACTCCAAACGATGATCTTTACTCACGCCACGCGAGAGATCACGATTCAGAGTG
CGTCGGGTTCCAGCAGCGTTATGGCACATGCCAGCTTCGCTTTGGAGCTTTGCCACCTGAGTTTCAAGTTCCTGAACGCGACCGATGAGCGACGATGCCC
AACTTGGGAGAGCTCCCGGTGAGGGTGCAGCTTTCGCAGTTTGCTCACCGCTGTCAGGTTCGGGTGGCAAAGGTGCATCAACCTTTGTGCTTCCCATTGC
TTTTTCACACTGCGTCTGGGATGATGAAGTGCTAACGGTTGCGTTAGTATTACATTGCTCAACTCCATTTCCTTCGTTGCCTGGCGCATCTCCACTCTGA
AAATGAGTGCGGGCTTTGACCCCAACGGCATAGCTCAGGAATAGTGGCACTTCTTCTGCCAAAGTCTTCGTTTGCTTACGATCTGCACCCTTGGCACCAA
CCTTAGTCCCTGGTCTTGGTTTGACCGAGCTTTTCGTAGCTTTGCTCAAAGCGAACTGAAAGTGATATGCACGCTCTGTCCACGGGTGAGCACGTAGAGA
AGTCATAGATTCAGCGTGTTTGGAGACCCAAACGCGGAATTCCTTTTCGTACATGTGTATTGTTTCGCCCGGATACAGCAGCACCGGGATTTTCCGTAAC
TTATGCTGTAGCGTACTCGTATGGTTTTGCCTGCGATCCATGAATTCGAGTTGATATTCCTTCGGAGTGAGAACTCGCTGCGCCAACACTTCATCTCGAG
TTCTTGCAATAGCAACACTGTCGCTGGCCATATCGTGCCGCGGTCGCTTGCTCTCCTGCAACGTGACCTCATTCGGAGTTTGCCTCTTCCTATCATAGAC
GAGCGATTCTGATACAATCGATTCTGCTCTTAAGTAGGCGAATGAGAACCAAAAGTTCCGCTCTCGAGATGGATCGCCCCTCAACGCAGGCAAACTTTGC
CCTCGGTGTGTCAACCATTGCTCAAATTTGTGTGTATAGCTCGACAAAGTTTCTCCAGGATATAACGGCACTGGAATTTCCCTCGAGGGCTGCTGATCGG
ACAAAGAAATGTTTCGGTGATCGCGTATTTCTTCCCGTAGTTGTTCTACGGTGGTCAGATGCTTGGTGAGAAGCCGGCGACGATACTCCCAGGGAGTCTC
TGGAGAGCGCTTGGTGGGCAACTCCAAAGCAACCGGCATCTTGTCTCTTGACATGGCAGTTGGTCTGAAAAGTTTTTGTCTTTGTTTTTCATTGTGTCTA
AAATCTCCCTAAAACCTCATCAGCCGTTTTGGGCGGATCTTGAAGCGGCGCATATCTCAAGATCTCAAGAAAGCAGTATTCTTGTTAATGTCGCGCCGGT
ACCTGACGCCGGCGTCTGCATCGCAACACATATTGGCATCGTCCGACGATTCCTCGTGGGAGAGCTTCCAGAAGCTTTTTGCATCTGCAGCGGACCCACA
GACGCAAAACAATCATGCGCGGCACCTGGCTCTCACGAAAAATATACTCTACGAGAACGAACTCGGGTACGGCGACGCTTAGTGCTGATCTGACTCCAGC
AGAAAGATTCACGCTGGTGATTTTGGCGAATTAGGTGGAAGATAGCAGAGTTGCCGCTTGTCAGCGAGTTGCTCAAGTTGTTGGCCACGAAAGTACTGGA
CAGAGTTCCACAATTTGCTGAGCAACTTGTCCTGGCTGTCGTGAGATGTTGCAAGGTAAGGAGGGTCTCAACGTAAAATAGGTTCGCTTGTGTCGTGCTG
AGGGTGTTGACTGTTTGCCATGCAGCCTTTTATCCGACAAAAGTCGAACGAAGAGATTACCAACCCCAGTTTGCTTCATGAGATTCTTCCTACTCTGGGG
GAACTCTTGTCCTTCGACGATATTGAAGTGCAAGTTGCAGCTGCGGAGGCATTGCGGGTGTTTGCAACAGGAGCATGTACGATGGAACAAGTCAGTGACT
AATGTGCAAGTGTGTGCTCACATGAGTTTGTTTAAAATGACACCAGGCTTGCCACGAGTTGCACCGAAAACAAGGAGCAATAATGCTGAAGGCAAGTCGG
ATGACTTGCGACTGACGCCACGGATCTTTAGCCAGAACCTTATGGAGGAGACGGGGGCGGTGGACGCGATCGTGGCGGTCATGCATGATCTCTTCCCTGA
TGACGATCTAAGGGAAGAAGAGCAGGAGCCCCAACTGATAGAGAGTGTTCCAGATTTCACAAACGACTTTGAGAATACCGAGGACCAGCCTCCGACTCAA
AATCAGGAAGAGGAATCTACAACCAATGAAGAAGCACAGGCTGAGGAAACGGTTGTCGAAGCAACCCCACAAGATAACGAAATTCCACAGCCCGCAAAAA
AGCCTGTGTCGGCTCCTCCGTATGGCCGCAAGGGCTCTTTTAGCCGTGATGAGAATATCATTGTTGATACGAAGGAAGATGCAAACGAGGACAACACCGC
AGCACATCACAGTCAAATATCTGTCCGATCTACTAAGCCAGCCTCGGCCCCTAGTGCGATTCACCGAGGGTCAAAAAGCGTGGACGGTGTAAACATGGGC
TCAGATAGCCAGCACCGAGATGATACTCCCGAACATGGTAACGACGCTACCAGCAGACCAGGGTCAGCCTCCATGTATGCTCAAGAAGATCAACAACTCA
GCGAGACTGATGGCCGTGTAGAAGATGAGCTGGTACGAGTGACTGGGAACGCACTGCCTATTCATATGAGGCTGTCCATGTTGCTGTTCCCACTCATCGA
TTTGTTATACGAGCTTTCGGCCTATCAACGTTGTGCAGAGGTGCTGGTCGTGAGCGGCGCGCTCCACTACATCGTTTTCATCCTCGAAAACATCACAAAC
CCGCAGGACGAACTCCTTCCCCTGTGTCTCGAAATCTTGTGGAATGTGTTGGAGCTTAGCCACGAAAAAATATCTGCGGTCACGAAGTGTGCGTCGAGAA
AGGAGTTGCTTGAAGTTTTTCGGCTGCGAAATGCCACGTTCTTCTTGGGCAATGAGTTCACATTTCAAGCGCTGTTGCATGTGCTGGAACTTCTCCTTGC
TCATGGCTATCGACAGCAAGACAAAGAGATGCGCAACGAATGCCTGATGATCTTGCAATTGCTTGCCAAAAGGCGGCGCTCCATGGACTTCTTTTACTCG
ACGGGCTTGACTGCCTGCCTGTTTTCCTATGCGACTTCAGCAGAACTCTCCCATGCTAAGGGCTCCGGAACCTTACAGGGACGTTCTCAGCAGGATAAAT
CCTCTGCTACGGCTTCAGCTATAACAGCCAGCAACCAGTATTACGCTACAAACAGCGACGAGGATTTTGAGTTCAAACAAATGTTGTGGTTTTTGCTGGC
TGAGATTTCGTGCGACCATCAAGCGAATCTGAGCGAGCTCGTACAATTCAGATTCATGGAGGTGTGGCTCTCGTACGCGACTGCCAATAATGTGCAGCAG
GATCAAGGTGCTCCACCCCGTGCTTCGGCTCACAAGTATTCAAGTCCACAACTGCAACTGCTGGAATGGACAGCGCTCAGTGTGCTGAATCACGTAGCCC
CGTTTGTGGTTGATCACTTTTACGAGATAGGTGGTCATGACCAGCTACTGGAGTTTCTTCAGCTCAATATGGGAACCGAGGACGTGCTAGCCTCTGCGTG
GCTTTTACTGCTTCAGATTGCGCCACCGCAGCCTTTCTTTCAATCCGAGCTGGGCAAACTTAGTGCTATCGAGACAGCGATGGACATATTCGAGGCACCC
CCGTCGCGACACACGTTCGCGATTCGCCGGAATGCCATTTTGGCGTGCGCTAGTATGTGCCGTAATGACGATGGTTCGAATCGCAAGCGCTTCCGTCTTG
CCAACGGTGTCCACGCGCTCGTTCAGCACCTCGAGTTCGACCCGTCACACTCGGTTCTGGAGGAAAACATCCTGGTTGGAATTATTGACGCCGTGCGTTC
GTGTGTGATTGGAGATCTTGAGAGCGAGACGGCCTTCATCAACGAAAATGGCGTGCCAAAACTACTTTCGATCCTGGGACCAGCACCCAAGGCGCTGAAA
CACCAGGCCCTGGCGGCACTAGCTGAGATATGCGTAAACCCAGCAGCAATTCCGTCTTATCAGATGTGGCGTTGTGACCAACCTGGTGACAACAACAATG
CTAGTGCCAACGAAGTGCTGCTTCGCATCTACGCACACGAAGAAGCTGCTGAAAAGCGTGCTAACGAGGACTCCGATGATAATCATATCAACTCAGCAGC
ACAATCCGCAAGCGACCTTGTAGCATCGACCAATGTCCGCCACAGCGCCTTCCTGTCTGTCACGACCTGTAGAAGCCCCTTTATCATCACACCAGAGAAC
AGTGGCCCAAGCGACGCACCACCGTCGCCAACAAGCAGGCCAGAGTCACCAGCATTCTCAAGACTGAAAGACGCTCTAAAGGCTGGCCAAGGATTGGCAT
CGGACAAGCAGTCAACACGCTCCGTCCTGCAGCTGGAAGATCACCAACTTCACCCAGAAGTGAACCTGAAGGCCAAAATCTACTCCGTCTTGGCGAATGT
GTCGTTCGCGTGTGAGGCTGAAAGCCTCACGCCGCAGGATCAGGTGATGCTGGAGATTGCGAAGGAGTACCCGACATTCAAGCTGGGCGAGATGTGGCAA
AATGTGGAGCGTGCGCTACATGCGGAGGGTGTGCGTCCGATCTACGCGGACGCTCTTTATATCCGGAAGAACATCGAGCACGCCTACAACATTTCCGTGT
GCACCAAACTCGCCCAGCAAGAAGTGTTCACGCGCTCACGGCAGCAAAACACAGAGCGAGAAGACGCCTTCTTCGAGCAGATTCTGCGCCAGAAGCACCA
GGAAGCGCAAGCGGAAGAATTCCACCGCGCGAATCGCCGCCAGAATTCCACGATGCAACTTCACCTGGACGCCAAGAAAACACGCTTGGAGTTTATGCGT
CGGCAGGATCCAGCTGCTTTTGCTGCCTACGAAAGCGAGGAGCGCTGTCGAATCCGCGACCCTCCTCCGGAATACGTCGATGAGCAAGAGTCGTACCGAA
CGCTTCAGCAAAATGAGGCAGAGCTGCGTGGCCGACTCAGCACCATCACTCGATCTCGCTAGCACACAGTGTAGAGTTAACACGTCCCACATAATCGACA
GGGTTTCAAAAAGCCGTCGCTGCTGTCTTGTCGATTAGGCGTCTTCAAGGTCAGCGCTTTCAGCGCGCAGATCCTCCAGGATTTCGTTGATACGGACCAC
ACAGTCAGTGTGTTTGGCTGACAGCGTTTGCACCGACCGCTCCAAGAACGCAATGGTAGACTCATCAGGCTCTGGCTGCTTCGTTGCATCGCTCAGACGC
ATCTTCTCAATCAGCACCGCCGACGTCTAGCACCAACAGCAACAGCAAGTTAGTTGCATCAATACTCAAGCCACTGCATGGATAACCAAATGAGCATATT
TTACCAGAAGCAGCTTCTCCTTCTCTTCCAGCTGCACTTTGCGCACAAGCTGCGCGATCACCACTTGCTGCTTCTCGTCACGGAGCAGCTTCTCCACGCA
GTTAATCTGCTCACTGACAGCCGAGAAGCGCTCCGTAATGTCAGAACCTGCATCATAAATAACGCAAAAAGAAAAAGTTAGCTACTAAATCTATTGAAAC
CCTGAGACGTGAGCACTTCTCTCCGCTCACAGAAGTTCGGGAATTGCTCCGTCTTTTGGTGCACTTGGAAGCCCCTATATTCCATGGCAACCATAAATGT
ACGTAAATTACTATGCAATCCCTCCAACTTAGAATATTTATTAGCAGTGACGCACTGGCGGAACTCGGTGTAGATCTGGACGCGCGTCTCCTGCAGACGG
TGGAAGGTCTGCACCAGCGCTTGGGCACTCAACACCGCCAGGTCCTCCAGCTCCTCCAACTTGGAATTTTCTTCCTTCTGGGGGACATCCGCGTCCTCTT
GCTTGTGCTCAGCGTGCTGCTCGTCCTCGCAGTGCTCGTGGGCGTGCGCTGGCCGCGTGGACAGGAGCGAGAAACACTCCTGGAACTCCATCGATCGTCT
CCTTCAGCTCGTAAAAAATACTCTGGATAGGAATAATGAGATTTGAGTGCATAGAAATAAAGAAGTGTATTTGATCAATACAAATCTGTACAAATACAGA
TTGTACCCAATTCCCGCTGTTGGCTTGCACTTCAAGTACATTACATTAGCATGCCTCGCCCAGCGAGCCATCCTTGGGAATCAGCCAGCAGTGATCGAGC
TTGGCCCCGCCCTTGACCGTGTCAGCCTTGTTGGAGGCGAAGACCCACGCGTCGTCGAAAGTCACGAATTGTATCTTCATCTGGTCGGCCGCGAACGAAA
GCTCAAAAATTCCATACGGAGCATTAACCCCTCGCCAGAtcgacgtgatgtcggacgcgtacgggggaggttcgccgatgctttcgctctggatgccgcc
tccagcgccgtttgtcacgaaatgcgtgttgaaagacccaaactcgtggctttcggcgtgggtgtggccgttgatgaacaagtggatgccccccttcttc
agaatgctgttcacttccgccatcatgctcgggttcatgtgaaaatgcggggagtagtgagtgttgaccaccttccacgtcgcgctggagttgacagcgt
ctctcagtagttgctttaaggaatcggcttgccacgcctcaatttgtgccatgcacgcgtccagcatttggacgtcacctccagcacacagtcggtcgcc
acgcgccacgtccgaacagctctcggggtagccgtacttcatctggtagccatagcactgacagcaaatttgcagcccgccgtgaaccgcagcagcattt
gtgtcgatgttgaagacgtcgacggtcactcctgagtccggatcttccaggcgctcgacgtagtagcgatcgggcatctgccagcgatcgttgttGGGAC
TCACATACGTGCTCTGTCTGGTGAACTTCTCGTCCAGTTGCTTGAGCAAGTCTGCAGTCCCCGAGCACTCCACGAACTCGTTGTCGCGCTTTCCGCAGAT
GAACATGGATCCGCCGAGGTCGTGGTTGCCAGCGACGTTGAGCCACTTGATGTCCAGCAGAGCGGGGTCCGAGTACATAGTCTCGAATGAATTCAAGAAG
CGATAGTTCACATCATCGGATCCCAAACCGTTCCAGTAGAAGTTGTCACTGCAAAACACAGGAGAGCTTTAGTCTCCCCAAAAAAACCCTTAGATCTCGC
GATGCCGCCTTACCCGTGGCCAAGAATGGCTTTCGGCTGCAATTTCTTGGCTGAAAGCGTCAGCAGATACGCCACGTTTGCCTGTGCCTGCTGGTCTTTG
TAGTACTCGTTGTTGCCCGTTCCAGTCTTGCGGTACACGTTGCAGCACGAACCAAGCCCGAGGTCCACTCCCCAGTCGCCGATGGCCAACGCATGCAGGT
CGTAGGTCGCCGTGTGAGACACCGTTGCCGGTGTCGACGAAGATGTCGTGTTCGAAGTCGAGCTTGAACTGGAGCTGGAGCTGGAGCTTGAGCTGCACTG
GAAACCAAGGAAGGTTGTCGCTGATGAACTGGCACAGACGATCGGCGTGACCAAATCGTTCCCAGTCACAGCACCAACTTCGTCACTCAATTCAATTCGA
GCTGTCGAACGCAGGAACTGGGGATCCGACAGCGAAGTAGCACTCGACGGTGCAAGCAGCGCAGCCACCAGTACTAGCGACTTCATCGCCAACTCCGTGA
TTTGAGATATGGATTTGGATCGGCCGGATCCGCTCGACCGAGGGTCGCACCTCGACCTTTCGCCGTCATTGAATCCTATCCTACTGTCTACTAGTGTAGA
ATTCCTACACTAGTAGACAGTAGGATAGGACTAGGGTAGGATTCCTACACTAGCAGACAGTAGGATAGGATTCAATGACGGCGAAGGATTCCTACACTAG
TAGATCGATTCCAGAAAGGAGCACATATCGTGCATTTGCTTCGTCATCCACGACAAAATGGTGACGTTCTTTGCTATCTTTGGTCGAACTCAGCTCAGCA
TATCTCCGCATCACATCCTCGATGCTGGGCGGCTTGATCTTATCGCACCACTATTTAAATAGATGTGTCACGCCGGACGAGTGCGCCAAGGAGAGGTCGC
AAGCCTACATGCTTAAGACAACCAAGTAGTGGAAGTCGCACGCTGGAGCCGACAAAATCGAGTCACGCAGACGTCTTCTACTGGTGTCTTCTTGCCCGAA
GTAACCAATTGCTGCGACTGGTATGGGTGCGTTCGACTCGCCCGAGGGCCATCGGCGAGTTCACATTATCGACGACCTACTGGGAGCGGTCCTGGTGCTG
GCGGCATTGGGGTTCGCGTTGCTGCTTGAGCTCACACGAAGGCAAATTTGTGCCGTCTACCAGTTGGCGTTCATTCTCTGCGGCTTCGTTGCCTTCTTTA
TTATCGGTGGGATCGTGGACCATCACCTGACCGACGAACAGATCACACTCGCGCTATACGGCTCCTACCTGTCGAGTTCTCTCACGACGTCGTACGTGTA
CCTGCCAATCATGGCGGTTTTGGGTGTTTCGTTTGCTGCTCTGGTGCAGCTTTCGCTATGTTCGTGTCAGTGCTGCTGCCTCGTGGGAGCTGCGAGCGTG
GCGCACAGCCACTGCTTCGCTGCGAGAATACGCGCCAACATGTCGTTGTATACAACCAGCTTCGTGGCACTATCAGGTGCAATGGGGGCGAGACTAAATG
CCAGACTACGCGAGTCGGCCATCAACCCTGAAGGTGGCACCGTACACTGGACAATGATGCGGGCTCCATTCTTCTTGGCCATAGCACACATCGGGAGTTT
GTTGTTCGTGACGCTCAAGCTTTTCTTGCAGCACGTACGTAACTCTGTCACCAGTTGCTGTTTTTTAATTCTCACACACCACATATTTGCGTCTTCCCAC
AGGCGGACAAGGCACCAGTACCGTCATCTCGAGCTGATTTCTTGCTAGATCGTGTTCCCCCAACAACTGTCGAAGACCTCACACGGCCCCCACCAGCACC
TAAAAAGGTGCGAAATCTCTAGCCTTTAACATATGATCTTCGCCCCCTGACGTTTTGTTCGTGACTTTCACTGCTAGCTCCCACAAATGTATGCTTCTCT
GGAGAAGAAGACCAACCAAACACGAAAACCCACAAACTCGTCTGCAGCAACAGCACTTGCGGATGCGATGGCAGCTCGAGGCGGCCAACGCCGTGAATTG
CAATTGCAGGGGCCCGGATCCCCTGATCGAATGGAACGCTCCAACAATAACGATGGCGATGTATCTTCACTGATCAGCAGTGACAGCGAGAGCGACGACG
AGGTCTTGCAGCCGGTGTTCAAAACGGTGGCAGCAGCTGCTGCTGTAGCCGGAGGTCGAGCTGGAAGTCCTCGACGTTCTGTGCACTCGGGGTATACATC
CAGTCCTCCGGCATCCCCGACATCTTCAATCGGGTCGTCGCTATCAACATCACCGATTGCCCGATCACGCGCGATGCTGTATCAAGCAGGTAGCACCGCC
AGCGAATCCGCCTGGAGTGACTACGAAGACACCATAGATCGACTTTCCTCGCGCGATTATTATAGTGATCGCCCGTCCACAGCTTCATCCACATCCACGG
TCTCCGTACATGGCTTACGCCGTCGTGCCAGCGCTGCAAACTACTCTTCGATGTCGATGGCTCGCAGAGACTCCACATCAACCTCAGCCGCCCCGCAATT
CGCGGAGACAACAAGGCATACTCCGTCTGAATCACCGTGGATCCCCTGCATTGATCC