Description :
From Genome Similarity Track
Location :
Scaffold_35:86721- 88217
Transcript NameFunction/comments
Phyra_78836Amino Acid/Auxin Permease (AAAP) Family

Sequence
1496 bases(100 bases per row)
CATCAAGCCCATCGAACCTTTGCAACCATGGGAAGCGGGAAGTTCATGACGATGGAGGACTTCAAGATGGCCTTCAACGTCTTCTGCTGCGTCTACGGCG
TTGGTACACTTGGTATGCCCGGCAACTTCTCGCGTGCTGGCCCCGTCCTGGCCGTCATCGCCATGGCCTTCATGGCCTTCGCCAACATCTACGCGTCCGT
CGCCATCTGCCGCGTCATGCTGCTCGCGCCCAAGTCCGTGCGCACGTACGGAGACCTGGGCGCCTGGGCCATGGGCAAGTGGGGCCACTGGCTCGCCGTC
ATCTCGCAGATGGCCTCGTGTCTGCTCGTGCCCTGCGTCTTCCTCGTGCTGGGAGGTTCGCTGCTCGACGGCCTCTTCCCGGACGCCTTCAGCCAGTCCG
TGTGGATCATCTTGATGGCGCTCATGTGCCTGCCCGTGTGCCTCATCCCGACTCTCAAGGAAGGAGCGGGAGCCGCCTTCGCTGGCTGCCTCGGTACGAT
CATCGCAGACGTCATCGGCGTCGCCGTCGTCATGTACGGCATGCGTGGCCACCCGTCCGTGCCGGCGCCAGAGCTCAGCTTCGAGCAGGTGGCCGGTGTC
TTCGGCAACCTGTCGCTGGCCTACGGTGCCGGCGTGGTCATCCCCGCGCTGCAGCGCCAGCACAGCGAGCCCAAGCGCATGCCGCGCGTCGTCTTCTTCA
CGATCACGCTCATCTCGGTGCTCTTCCTCGTGTTGGCCAGCACGGCGTACTCAGCCGTGGGCTGCCAGATCACGGGCAACCTGCTCTTCTCTATCTACCC
GAACGCCGTCTCGGGACTCACGACACTCGGCTTCAAGTCGGACTGGGGTGCCGTTGTCCTGGCCTACCTCTTCATGCAGCTGCACGTGACCATCGCCTTC
TCCGTGCTGCTCAACCCGCCCTTCTACCTGGCCGAGCGCCTGGTTCTCGGGATGCACAAGAAGAAAGAGGGCGACATCGAGAACGCCATCTCGTACGCCG
ATGCCTCCACGCCCGCCAAGGAGTCCGTGAACGTGTCGGAGCGCCGCTCCAAGGTCTCGTACGTGTCCGTGGCGGACGCTGAGAACCCGCACTACGGCGA
CGAGGACGCCGAGGCTGCCGAGTACCGCGGCGCCAACGCCATCAAGTACGTGCTCATGCGCATGGCCATCATCGTGGTGCTCGTCATCCTGTCCATCGTG
CTCAAGGACCACTTCTCGGACCTGTCGGACTTTGTGGGCGCCTCGTGCATCTCGCTCAACAGCATTATCCTGCCCATCGTGTTCCTGCTCAAGAAGTGCT
GGAGCACGATCCCCATGTGGGAGAAGGTCCCCGCGCTCGCCGTCGTGGTCGTGTGCTGCGTGCTGGGCTGCTACGTGACGTACACGTCTGGCAAGACGCT
GTTCTCGCCCACGGACTCGGACGTCGAGTTCCCGTACTGCGACTCGGAATTCGAGAACACGGTGTACTACAACTACACGGCCGTGCACGAATCGTA