Description :
From Genome Similarity Track
Location :
Scaffold_843:8672- 11697
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_843-fgenesh-gene-0.5Mediator of RNA polymerase II transcription subunit
Pytir_DAOMBR486maker-pir_contig_843-fgenesh-gene-0.2Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_843-fgenesh-gene-0.3Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_843-fgenesh-gene-0.6FKBP-type peptidyl-prolyl cis-trans isomerase

Sequence
3025 bases(100 bases per row)
GCATGTTCTTGAGCTGGTCGAGCCCCAGGCGCTGCATCTTGAGGCGCTCGTTGTTGCACGAGCGGTCATAGAACGGCGAGAGCGCGAAGTAGTGGATCAC
CGTCTGCGTGTTCAGTGGGAACGACTGCAGCCACATCGTGTCGCGGAACGAGCCGTTGTAGTCGTCCACGTGCGTCGCCACCTCCATCTTGCTTTTACTC
GCCTTCGTTCTGTCTTGAGCTTTCGCTTACCGGCTTTGTTTGTGAGCGAGTGTGCGTTGGAGGTTGATACAATCGCATAGATCAAATATCAAACCATTAC
TTGTATCAACCAGAGGGATGCATTGTATATGAAAGGAATTTGTCCAACGATAAAATCAATTTAGTACTAAACAGAACACCACAAAACGCATTTATTAATT
ATATATTTATAAGATTAAACAGGAACGATCTCAAGTTGCCCTTTTGTGTCTCGCTTTTTCATCAGTTTGAAACATGGCGGACAGTGCGGAATGCGCGCGC
CAGAAGATGGCGACGGCATGCCGAATCCAAGACGCACATGTACACGCACACGACACCACCGACACAAGCAGCTCATCACAGCAGAGGCGGCTGAAGCGAG
CGCGCGCGGCTCCAGTCGTGTCGCCACCACTTCCGCCGCTGTGTGTGGAATATCGCGTGGCGCTTGACGGAATGATCTGCGTAGCGCTGGTGACGCATTT
GGTGCAGTTCTTGCTCTACTTTCGCGGCCAGATCCCATGGTACTGCAGTTCGCCAAGTGTATAGCGATGCTATTGATACTGTGTGTTTTGGACTACATGT
TACTGATGTGTATGTGTGTGTATGGGATTATGTGCTGCAGTGTATATGACGAGTTGCTTGGAATCGTCCTAGAGTATCAGGAGCAGGAGCAGCAAGCGCT
ACAACAGAGTCCTTCTGGCCCAGGCAGAAGAAGGTACGTGGGTATAGCTTTCTGGTGCTTGTGTGGAATGCGCTTTTATGAACCTACACATGGCTTATAT
TAGAAAAGTGCTGAGTGGGGCAATGAAGAAGGCGATCAAATGCATGACCACGACCGAGCGATTGTTTCAAACCAGCCTGAACGCGCTCTTTGAAGGAAGT
GTGCATTCTGGTAAGACAGGATGTGCCGATGCCTTAATGTATGATGAGAGCTGACTGGTGGCGTTGTGTCGTTGTTGTGTTCTGTGTGCTATCTGAATGG
CTAGTGGTGCTGATCTTTGGCGCGTCGGTGTTCAGTCCGCGGGAAGTGTTCGTGGTCGATTTTCTCAATGGAGACGAATCAACAAGCGGCGGGAGCGATT
CGAAGCTTCCAAAGGAAAAAGTGGTGCGATTATGCGCTCAGAAGCTCATCCGCACGCTCATTGCTTCCAGCACGCAGCGATTTACAAGGTACGAACTCTG
GATCGATTGCCACAGGCGACACTCGGCATGTTATGCTTGCTGTGCTCACTGATGGACGTGTTTCTTTTGTTATGCTAAAGTGGTCTGACAGTGACGTCGC
TGCATATTGCGGCACTGGCAGAGAAGCGAGCGAGCGGGATTCCAGGATTCGTGCCAAAGCAGTCTTTCCGGCTGCGATTGCCGAGGTCCAAGCAAGCGAA
CAGCCGAACGTATCACTTCTGCATCAGCGGCGGCAATACACTGTCTTCCAGTCCAGTTTTAGTAGGCAATCCTCCTTCGTCTCAAGATGCAAGACAAAGC
GCGACAGAGATGCAGGAGAATGGTGACAACAGAAGCCAATTGTACGAGAAGCAGGAGCCAGAGCCTTGGTTTCGTCAAAAGATTCCGGTTCTCGATCCGA
GCTTGATTTGGTACACGTTCGACAATCCGATTGCAGGGTTCGCGGGGGCTCTTTGAAAACTGCATTCAACATCTGAAGCAAATAGGCAACATCTTGGTAA
GTCTTGCTCTCGATTTTTGCAGCTCTCTGGTTATTTGATATCTGACAAAGTGTTCTCCGCATCTTTCAGTTGAGGTGGCACACCTCAGTGATGTTTCACC
TGACTTTGAGACCCAATAAATGAAGACGAGTTCCAAAAATACTTGGCTTGTCTGAGTTCCTGGGGTGACCCAAGGCTGTAGAGAGACTGAAAGCGTGATT
CCCCGTCCGAGGTGGAGTCAAACAATAGCCGTGCAAAGAGAAGCGAACAGGTCTTCGGGAAGTGCACTACAAAATGCTGAGTCCCTCCGGTTCAATTTCC
TCGTTCGCGTCGCTGGAAGAGCAGATTGCGCATCTGAACTGGCGCAAAGTGTGCAATGAGCGGCAAATCCAGGGAACGCTTCGGCTGAGCAAGCAGCTGC
AGGAGCGAGACGAGTTCCTGCGAGCAGCAAAGACAGATTCAAAGGAGAAGCGCGAGTGGATGCATTCGGTGATCAAGCAGGAGTTCAACAAGCCGCTGCC
AGTCATGGCGTATCAGTATGACGAACTCACGACGCAGCTCCAAGAAGACGAGAAAAAGGTGCAGCTGAGCGCGAAGAAACACATGACGCAGATCAAGTCG
ATCCAGTCGAAGCTCGACGCGCGGGAAGCGCAACTGCTGAGAAAGAAGGAGTTTGAGCGCAAGAAGAAGGAGCTTTTCGAGGAATAAAAACAGCTTGAAC
AGCTTTTACAATGGCAACCCAAGCGAGCTAAATCAAGCGCCTAGCGGAATGTGAGTAGCTCTAAATCAAATATCAAGTTGCTATTCGGAGGAACGAGTCC
CGGGAACCCTTTGCGTCCGTACGCCTTGTCTGCAGGGATGAAGATCTTGGCGCGTTCTTTCATGCACAGACGCTCGACGCCTTCGTCAAGACCCGGGATA
ACCTGCTCAGCGCCGAGTTTGAACTTGAACGGCTTCTCTCGATCTCGAGACGAGTCGAACTTCTTCCCGTCCTGGAGCTACGACAAGATGGAGAAGAAGA
TACATCACAGGCAGGTAAGTACAGCAGTTCATTCCAGCATGTCGCTCTCAGAGATTTCACTTACGTATCCAGTGTAGTGCACGACCACGGTTTGCCCTTT
CTTCGGGTAGTTGATGCCATCGCCC