Description :
From Genome Similarity Track
Location :
Scaffold_25:86706- 101095
Transcript NameFunction/comments
Phypl_g1062hypothetical protein PHYSODRAFT_488619
Phypl_g1063hypothetical protein PHYSODRAFT_313188
Phypl_g1064hypothetical protein
Phypl_g1065hypothetical protein PHYSODRAFT_313186
Phypl_g1066hypothetical protein PHYSODRAFT_492063
Phypl_g1067hypothetical protein PHYSODRAFT_492857
Phypl_g1068eukaryotic translation initiation factor 3 subunit, putative

Sequence
14389 bases(100 bases per row)
CTTCATGGCAGCCACCGTAGAGATTGTATCCCTTGATGTGTCAATGGCAAACGCCGCCTATACGCCAAGCACGTAACCATAGCACATCAGAGCCCTGAAC
TACACTGTATTCGTTCCAAAGGCGTGACAACAGCGCACACCGCACCTGGTCAATGTTAAAGGACTGGGCCTGCAATTTGTCACGCTGCGCCTCGAAcatc
ttcttgcgcttgagcgtctgcatGGCTCGCTGCTTGATCGAGTTGACGGCTGGGCCccgcgtcttcttcatctgctcgCGATACTTGCGGAGCTCCTGGT
CCAGCTTCTCAATCTGCGGCGGCAACAAGTCAGCGCCTATTGCGTCTGCCGCGCAGCCGAGCAGCTACAGCCATAAATGCGAACCTTCATGTCCAGGTCG
GTGACGCGGGCGTCCACCTTGCCCCCTACATCGGAGATGTTGACGGCCGGCGCCTCGggtttcttcttgccgaaAATGCGGTTCATCTTGTGTGCGAATG
CGCAGCTAGCACACCAAATGTACTGAAATGATTGTATCCCCAAAAATCCACTATGCAAGGCAACTTGCACAGGCGATGCTTCGAGTGCATGCAGCTAGCT
AACTAAGTCAGATATCAAGCTGGTTGGGACCAGTAGTCTAAGCTGTAAAAAAAAGTACATGTAGGGGTCAAAGTTGTGGATCGACTTGGACACGTTGGCA
CGAAGCTCCCGAGTTTCCAAACCTTCTTGACAATCGTTACCGGCACAAAGCCACTCAATCAAAGACACACGCTGTGCACTTCGTAAAAGACGATCTTCAT
TGTGAAGGACTTAATGAGGTCCATGGCTAGCTCGAAGCATTTTGTAGATTCCTCCGTGCTTCTGTCTACCGAACGTGCGTGGGGGCGAGATCTACACAAT
AAACAGTCGTGTGAGCGTTGTCGTCGCAGAGCCGAGGTATTGGAAACACGAACAAACCTTGGATACagatggcgccgctgctgcatgtacTTCTGAAGGA
AATAACGTATCAAGGCAGGAGTTAACCAGGACAATACTCAATAGTAAATAGTGAAGTAGCGCACCTTCAGGGTTGTGTGCGTCTTCTACGAGGACTGGTT
CCTGTTTCACGGGTTTGTTCTTCAGTAGCAGTGAGTAGATCCCGCCGTGCCTGGCCTTCCCTCGAACTTCCGGTAACGTTGGGAGCGAAGATCGTGTTAT
CCTTGACGCAGCTCTATCCGGTCCACAGTTTCTATAACTTCTTGGGTTTGGCGTGGCAGCTCTAGCGGCAAGTGAGACTGATGAGGCTCGACGCTCAGGT
CGTTGGACGCTCTTGGATTGTGTCAGACGACGGAATGCCTCTGCTCTTGTGCGTACGTCTTCGAGTGCTGGTGAAGTTGGTTCAAGGTCCCAGGCTAAAG
CGATCCTTGGTCGAGTCTGTGAAGGCGTGTCCGGCAGCGCCATGGGGGAAGCTAAGCCGTAGTCGTCGTCTGCTGATGACTGGGTGGGTGAGCGCGGGAA
CGATGGAACAAATGCTGTCGGTGAGGCGATATTCAGCGGCATGGGTTTTCTAGTAAGCGACATCTCTTTCGTCTTGCACGGGGAATGCTCTGGTCGAACT
GGTGCGGTGCTTGGCATGCattcctcctcgtcgctttGCCACTGTTGGTTCTCGCCGTGCGGACTCTGTAGTGCCTGTTGCAGCGCGACACACGAACAGg
gtgagctgcagccgacGGTTCAACCAACACGCAGACATTTCGTACTCACCAGGAGCTCCAACGAAACCGAGTCGACGTcggtctccagctcctcctccct
cgctgcagccgccggcAGCTGGTTGCTCATCGTATGCGGGATTGCAGTCCCAGGGAGGACCAAGTCTAGCTCCAGATCCAGCAGTTCGTCCAGCGATGTG
GCTCTGCTCGGATCTCCAGTCACGAACGGCTCTGCGCCTTCGTCCCAGTCCGGagactgttgctgctgcagaggaAAATGAGGTTTGGACGATCGAATGC
TGGGCTCCGGCGCGTGCGCATCCTCTTGGTTGCCAtcgcgcttcttcagcagcaagcggcTGGGTAGAACAGCCTTGGTCatggctgcagcttcgtcact
GCGCTAAACCGGCACTTGAACCTCGCGTCGTTTCGTGCCCCTTCGCCAATATCGCAGTACAAAATTGCCCTTCAGTCGTGAATATTGCATTACGTGTCGT
CGAGATCTACGGAGCGGCAAAGGCGCGATGGGGCTGCTGAGTATCctcaagaaggtcaaggagaaggagaaggagatccGCGTCCTCATGCTGTGCGTCC
TTACGTCTGCCGCGTTGCGGTCGTTGCTTTGTCCGCCGGGAAGTGGCCCGTACGTTGACTGGAGCTGACGAGTTGACTGCCTCGATTTGGACCACCAGGG
GCCTGGACAACGCCGGCAAGACGACAATCCTCAAGAAGTTCATGGGTCAGGACATCACGGAGATCTCCCCcacgctgggcttcgacATCCAGACGCTCGA
GTACAAGGAGTGAGTGGATGGCCGGTGAAGGCCTTGGCTGGTTGGATCCCGTTCTCGTGAGAGACTCACCACTCACCActcgctgtgctgctgctgctcg
ctaTTAGCTTCAAGTTGAATGTATGGGACGTCGGTGGCCAGCAGACGATTCGCTCGTACTGGAGAAACTACTTCGAACAGGTTTGAGCTAGAAtctgctg
gtggtggacctGGAGGCGGGCTGAAATGAAGCTGACCGTGTGGGTATGATACGACAGACGGATGGCCTCGTGTGGGTGGTGGACAGCGCCGACCGACGGA
GACTTGAAGATTGCAAGCGCGAACTCACAAGCCTGCTGACGCAAgaggtgtgtgtgtgtggcgcCAATGGGCACTATGTATTTGTTGCTACTAGCCTTCT
CACCTCTTCATTGCGCCACTGCTCCCAGAAACTAGCGGGGGCTACGTTGCTGATCTTCGCCAACAAGCAGGACCTCCCTGGCGCTCTTTCTTCTGCAGAG
ATTGCAGATGCACTTGGACTGCGGTCGACCCAGTTTTCGACCCGACATTGGAGGATcgtctcctgcagcgccgtcactggcgatggcctcgtcgacggca
tcgactGGCTCGTCGGTGACGTCGCTAGCCGCATTTTCCTAATGGAGTAGCGTATTGGGGTCGGGGCCTGAATCAAGCGGACGGCTTCTACAGACTTAAC
CTGTGCTAGCGTTTTGCTTGAGATTGCGTGAAGGACTGCCGCCGAGTTGGCAGAACTAGCAGCCAAGATGGCCAGCCCCAACCACTTGTCCGTAGTATCA
GCTAGTGCAGTTTCACCACCGCCTAGTTTGTCCTCCGACACGCGTTGAAGTTCGCGAGCTTCACGTCTCTGCGTAGTAAATGGCACTGCCATATCCACGT
GTAGGAAGGATGTCTCTCAAGTACTTTCGTACGACTTTCGTACGACTTCGAACCACACATACACAATCCAAGCACTCACTCGCTGATTCGCAAGaaacaa
acaaaaacaaaaatcTGCTCGAAAGCTTCGGGACGAGAGCATGGAGCCGTTGGCGGAGCGCGCGGAGGCGCTAGCCTTCGACATGGGCGTGCGTCTGTGG
CGCGTGGAGGTCGCCCTAGCCGcgcggaagctgctgtcgctgggccTCGCCTACGAGGTCCGCTACTCGCTGCCTCGCGGCCCCGTGGAcagcctgcagc
tggccTCGCACTTGGGGCTCTCGGTGATCGCGCTCATGAACTCGCACCTGTTCCAAGTGCAGAAGACCGAGACGCCCAAGTACGCGATGGAGTTCGTGGA
CAAAGTGGCCGGCAGGTCCTCCGCCCCCATCTGCACCGTCGAACCGCACGACTATTTGGTGGGCATGGGCGTGGAGGATTTCCTCCTCTGTCCGCGGAAA
CTCAAGCAGCTGCACAGGGACGTGGCGGCTGTGGGGGCAGAGGTCCGcatcaagcaggagcaggacaAAGCCACCAGAAggacgctggtgctgcgcttcg
tgcgcCTGGGGAAGTCGGCGCAGCCTGATCCAAGACTGGGACGCACTCCAGGACGCATGCTTCGGATTCTGGACGAGATAGCGacccaccagcagcaact
agTTAAGCGCTATGACGTACTGATCCAGCAGGATCGACGGAcagtgcagcggctgcactcggccaagaagctgctgataTACGTGAAGATCATGACTGGA
GATACAAGAAACACGCTGACGGAGGACAGGACGTTCCAGTTTACCGACAAGTTTCGGAAATGGTATGCAGCGATCAGGAGTGAAGAAATGGAGGAGGCTA
TCTCCCGGGACAAGCAGGTCGCCAAGGCCAATGGGGAGGTGCCAGTGGAGGACATGGCGGTCGATATGAGCCCAGAGCAACCCGAAAATTACAGCTACAA
CAGCAACCCAGCTGTCCGGCCGATCACGACTTCCATACTGCGTCAGCggtcttcctcgtcgagcCCGTCGTTAGCGAAGAAACGAGTGAGATTTGCTATG
GATACTGATGGACCTGAACAGGTTGATGCTaaagctccagcaccaaTGCCGGTCCCTGCTCCTCCCCAATCTCGGCATGGACAACAGATTGCGGCTAACG
CTGCTCCCAAACCCAGGACATTCGGTGTTGATGAGGGCCAATCGTATCTTCTGGCTTTGGTCGCCCCTAACGTTGACCTTGTGTCATCGCTTGAAGAACT
AGCAACTGCTGTTCAAAATGTGCCATTGTCGACCATGAGCAAGGAATTTGAATTGGATCATGGACTTAAGGTGCGTATCCTGTCTTCTATTGTTGTGTTA
AGACCATTATGACTAACATTGTTTAACCAGCTTCGGCGCGAGTTGCGGATGGTTGGTCCATCTCAGTATATTGCACGCGTCCGTTTAGGGCATTTATCAT
TCGAGTGCGCTGATAAAGCTGACCGGAATGCCACTATTGGTGCACTATCGAGGCTGACAAGAGCAGCGCGGGAGCATCGAAGATTGTACTGTGACATGCT
GTTGTATTTGAAGTCTCAATTTGGCTTCTGCACAGCCAATGACACCCGAAAAGTGAAGGATGCGACCTTCAACTACCTCATTACCAAAAGGATTGTGCGG
GTACGTTCGCTTTCTACTTCGAGATATTGACGAGTGACTTCTTCAAGTTAATATGTTTTTGCTGTGCACAGCTTCACGAGAAGCCTAGTGGGGATCCCGG
AAATGTTGTTTATGATGTGGTGGCGCACATCCAGGAATTTCCTCTCGTTTGTAAACGGGGCTCATCTCTACCTAGCACGAAAAGCGAAGTAGTTGACGTG
CTCATGCTGTTCCTGATGAAATTAATCGATCAGTATGAGGAAAGCATGAAACGGGATCGCGCGAAGCAGATCAAGAATGAAATTGAACCCATCACAAGTG
AAAATACTCAGCCTCACCAAGATAACGCATACGACCACAGTGATGTGAATGATTACAATGAGATGGACGATGTGCGCGAAAGCGCCAGAAGAGCTGAAAA
TGGTGGTAGCAGGGACGCAGCGTTGAGATCTATGGGTATTCTGCGAAAGCGGCACTATGCCCCACATGCAGAAGATAACTATGAAGACGCGCGTGGCGTT
CCTCGTCCCCGCTTGTCGTATTCAGTCCCAGAACCACAAACACCAGAACCGGTACCGCCCGAAAGAAGATACGCCGAGCGAGAAGATGACAGTGTAGCTA
CTGCGAACACAGCAAGTCTGTTTGTGGAGGACCGAAGCGGTTCAGCTCCCAACCGTGATGCCCCTCCCCGCTCCAAAGATAAAGTTGCGAAGGCGAAATC
AGACGTGTATCAGGAGCTGTTAGTGCTACTCTTCCGAGATCGAGAAAAGGTTGTGGGAGCTATCAACGCAATTGTGTGGGATTTGAGCGTCCGGTCTGAG
ACAGTTAAGCTGTCATCGAGTTTTACGGTAGGCACTTGCGCCTGGGCTTTTTGGTATATGGCTGGTTTGACGTGTGCGTTTCGTATTTCATTTAGGTCTG
CCGAACCGCCACACAACAGAGCAGTAATCTCATCCGATGTGTGCTCAGAGCCTCTGAAGGTGTGGTTGAGGCTTGTGGGGAAGGATCGTCTATTGAAATC
GCGAAGGATCAGGCCACCTCGATTCTGATTAATACGCTGGACGGAATGATCCAGACGTGGAACGCACTACTTGCCACCTATAATGACCGACTAAAGCAAA
CCCCAACAACTCTGATGGCTGGTAACGAGACTCAAGCGAAAAATCAAGACAAGGTATGACTGTATGTATTTACTGATTATGTGATAGTAACGGAGCGCGG
AGAGTCTAACGACCTACATTTCCTGTACTGTGTCGTAGGTCTCAGCTTCGGAAAAACTTGTTCCACCGTTGTTCATGTACTTTATTAGGATCCGTAACAC
GCTTGCTATTTCGACGGCATGCCTAAACGCAAAAGATGCGAAGCGTTCTGCTAATGAAAGATGGCGCGACATTCTGGAATCTCTGAACAAGATGAAATCA
GGCCCTGCGACATCGTTTTCCTCGAATGGAAGGACCAATCCGGCAAGTACTGCGGCAGCATCACGATCTACAGCGACAAGTGCTTCGGCGGCAACTCCAG
TGAAGAAGTCCAACCTGATATTGTGCAGTGATGATGAGAtggatgatgacgatgactACGACAACTACTCGGATGGAGGGTTTGACGACGATAACTGGGA
TCCATCTGGGGTTAAACCGGCACAAGATGTGGCAGAACAGACATCAGCTTTTGAAATAGAGCTGAAAAGGGACTATGATGAACTGTCCGAAAGCAGTCTC
TCCGATGACGCCAAATTCCGCGCTGCAATCCGAAGTCTATTTACTCCTTCAGATGAGTTGTGCGCTGGGATCAACAGGCTTCGAGCGTCGCTGAAGTATC
GTGGAGCTGAACACAGAAGGATAGTTCCCAATGTTACAGCGAATATCAGGATGGAGCGCCTCCGAGAAGGCATCtttgaagttgctgtcgaTGTCAACGA
TGTCATTCACTACAAGGCGTCGGAGGTATCAAAGTCTGATGCTTGTaatgctgctgtcgatggtATGTTGAACAAGCTGAACAAGATTCGGTCGATCTGG
GCGCAACTTCTTCATTTCCTGGACGTAAAATCTCTGGCGTATGTATCACCCATTGATTCCTTCCGGGACCTCAAGTTGTCAGGCATCGCCAGTGTATGTA
CCTCGTCTTCGTAAACCCCTACTACTGCTTCGTACTAACTGTTTGTCATTCCTCTTCGCACCAGATTGTAACGTCAGTGGAGGACGCGCCTTTTGCTCGA
GATTCTCGCTCAACACCTGGTGTCCACTGCGCTGTTCAAGTAGACAATCATGTACTTTGTCGGGCTACATGGAACACAGAAGCGGAGGCTCGTCGCTTGG
CTGAGTGGAGAGCAGCCCAGTTTTTGATTGATTTGATCGATTGCGGTCTTGATACAAAGCCACTTGACGGGGCagacgagaagatggagatcgaTGGTGA
ATTGCCCATGGTAAGAAACTCCGTCGCTTGGTCGTGCCTGATTCGAATCGAGGACGCGTCTGATACCAGCAGCTTTCATGAGTTTCCGGTGGATGCTTTC
TGGTGCCGTTCACGCGATGGGATGGAGCCTGAGCAATTTTCAGTGATTCGACGCATCGTGGTGACCCAGCGTGGAACTGTGGGGATGCAGAGAATGGAGA
CCGAGGTCCGTAATCTCCATGAATCGGCAATGGCATTTTTCTGCTTGGAGTCCGCGTACGATCATTGGAAATTTGTACGGCAACTAGTTCGCTATTCAGA
CAAACGGAAGCACAACACTCGAGCACTTGCTCTGACGATTTCACCCGAGTGCCCGTACCACATGTACGTGATTCCGCCTGGAGCTTCCATCAATAGTGAC
CACAATAACTACTGGCCGGAGAAAGCGCTGCCTCGCTTTGGAATTGATCGTAAGAGTGTGATTGGATTCTTGACGAAGAAGGAAATTGGCTGAGTGTAGC
TAGCTGCATTGGCGTGAGGAGCAAGAAATAATACTGCAGAAAGCAGTTTGGTTTTATGTTTTTCTTAAGTTCGGCCTTCTGGTGGAGTACAATTACCTTA
GGTGATAAAGTAGCTTGTGCCAGTTTATCAGTGATCGTCATCATCCTCGTTGTCACTGTTGTCATCCATCCCGTGGTGCTTGCGGAATGTTGCGCTCTGC
GTTTCAGCGTGGATCATCTCGAGGTATTCAGCATTATGAATTTCAAATCTACGCTGGCGAATGAGGTGTCCGAAGTCACCGATCGCTCCACCGTCATTGA
GGTCATGGTCAAGAATCAAGTCCATGAGCACGTCGCACATCCGGCGCACTTCAATGTTAGGTgcgtcagcagcgagaagcaaGTCCGGCACAAAGCCGAC
ACCAAAGATAATCTCTTCAAACGTCACTGAGTGCCGCAGCATGCGGTAGAACGCATACAGTAGCTGCAGTGTGAGCTCGTTGTCGTGCTGTTTCTCCTGG
AAGAGCGAGTGGAACGTGCGCACAAGCCGAGATGACGACAGCAGAGGAGCGCACTTTGGCTCCAACGCGAGCGCGCTGACAAAAAGCACGACTTCGAGGA
TCATATCATCTTGCGAGAAACCCGGCACAAGGAGTTTGTTGAGGAACGGGATTAGTGAGTGGTCTGCCACCAACCTGTCCCAGGAAGTCTTCGACGGAAG
ATCACTCGGCGTCATGTTTGCTAGCGTTGCCAGAACTTCAATGGAAAAGTCGTGGTTGTCTGTGTTGAGGCATAGCTCGATGAATGGCACCACGAACGGG
GCCCACATGCCTCGGTATTTGTACGCCTTATCGCTGACCAGATCCTCTTGAAGCGTGTACGACCACAATGAAATGTTTCGAATCACCTTCATCAGGAGTG
GGTCGCGGGTGCGAAACACACGTGCGGCGAGTGCTTCTAGACCGCGGTTTTGGCACATGAGCTCGGCGTTGCGCGCGTTGTGGCTGAGGTTTACAGCCAG
CGCAGCTAGTTCCTTCGCCACGATATTCTGCGGGAAATTAATCACCAGCTGCATGACGATTGGGATTGCCTCCGTGTACGTGAACATCGACTTGCAGCGA
TCGTCGATGCTGAGGTGGTAGAGAATTCGTAGCGACAGCGCACGAAAAGGTGGCTTCTTGAGTAGGTCCACAAGCTTCGGGATAAGACTATTCCTCACCA
GTACTTCGCGAAGGGCCGGATCGAACGACAAATTAAACTGCAGCTTGAGTGCTGTTTGGATTGTTTTGTCGTGGTTGCAGTTGAGGTAGCGCACCAGTTT
TTCCACCACGGTAAGCTCCACCATTGCGTCCTTGTTTTCCTCAAAAatgctcagcttcttgaggaaTGTGATGGTTAGAATAACCAGATCGGGTGCAACA
CGATCCAGTAGCTGTTCAACAAAGGAATCCAAACGTTAGTTGCGTCTACATGTATACAACCGAGGAGAGACGAAGTACCTTGGTCAGGAACAGCACAATC
TTGCGTTTGACCATCTTGCGCTCGATATGAATGTCCTCGGCCAGATTCAGTAGCACACTAAAGCACACATAGCTGCAGACGATAACAGGCAGATATCAGT
TTACGAATGCCTAAAAGAGCCAAATACATCAGCAACTCGTTACGGCTCCCTCACAGTAGTTGGTCTTGCTTCTTCATGCGCTTCTTGTTacgcttcttct
cgcggtCTAGCTTTGCTAGAATACTATTCGTCGAGTCACTATCCCCCGTCGGGGCCTCGTTagccgcagcttccagcagtttTTCCTCTTCGAGGCGTAG
CTGGTGGCGCTTAAGCTCGAACTCGATGATCTTGAGCGTAATGGCCCCGATGCGGTAGTTGGCCAGCATCggatgcagctgcaggaagttgGAGAAGCAC
CAGAAGATGCGCATCATGGTGAGCGAGAAGTCGTAGCTCTTCTTGTAgtcgtcgttcagcacgcGCGACAGCAGACTCTGCAGCCAAGACGACAGATTAG
TACACAGTCTCCACTACTCtatctgcagctgcacggACCATGAGCGCCTCGTTCTGCACGAGTGCCTCGATGTTGCCcgcgaactcggcgagctgcagga
tcaTCTTGGCACCCTCCAGCTTGgactcgacgtcgtcgtcgtagagcttctccatgtaggcgtccagctcgtccgccttGGCCGTGATCTTGCGGGGTTT
CTTGTCCTTGAGGGCGGCCGTATGGCTCGGGCCGCGGCTGGAACTCGCACgggagctgctcatggcgCTGCCTCTTGGGGGACTGAGCCCCTGGCAGGAG
TTTCAAGGGACGTTGAAGCTTATTGGCCAATTAGGGACGGCCATCAGGTTTTGGCGCCAGCAAAGGGCAACTCAAACTCGCATTGGCGGGTGACTCAGAG
CCGCCTGACGTGACTTCTGCTGGCAGTGCGCAATTTGCCTGGGACGTGGaaagatggctacatctcGACTGGTGCAGCGTACCGCGGCCTTcgtggaaca
gcagctcaagagcaacGACGCGTCACACGACTGGCGCCACATCGAGCGCGTCTGGACGGTGGCGAGGACGCtggcgaaggaggaggtgcgTGCGTGCGAT
GACGGCTAGGGCGGGTTGAAGCGCGCTCTATCGCTGACAAGCCCTGTGGTGTCGtgtgcagcgcgtgcttgaGGAGAAcctggagatcgtggacttAGCA
GCACTGCTCCATGACATTGACGACTGGAAGTACCAgaacgacaaggagaagccCACGAAGCGCGCGGTGGCCTTCCTGCAGTCGGAGAGTGTGTCCAGCG
ACAAGATCGAGTGGGTGATGGCCATCATCGACAGCATGGGGTTCAaagaagagctggaaggCAAGGGATCGGTAAGTATGGTAcagtcttgctgctgttg
tttgGGTGGCCGAGACTAACGGTATTCGGTCGTCGGATATTCGCCAGCGATTGTTTTCTGTCGAGTACGGCTGCGTCCAGGATGCCGACCGATTGGTACG
TTGCCCATTGAGGCTCAAGTTTCTTAAGTGCACGGGGTTACTAAACCTCTGCTGCGTAGGATGCGATTGGAGCCATCGGAATTGCACGCTGCTTCACGTA
CGGAGGGCACAAGCTGCGGCCGCTGTACGACCCCGACGTGCCCCCTATCGACAGCATGACCAAAGAGCAGTACATGGACCCGAACCGCCCCAACACCACG
ATCAACCACTTCTACGAGGTATGGGGTTTCTAGGATTGCTGGTGCCAAAGCATTTAGTTTTGACATGTTGGGTTTTCTTGTGGTGGTTGCACTCCTTGCA
GAAACTACTGAAGCTCCGAGGCATGATGAAGACCAGCGCTGGAAAGCGTCTGGCTGAAGAACGTCACACCGTCATGGAGACGTTCCTGGACCAGTTCCAC
AAGGAGATCAGCGGCCGAGGCTAGGTCCACTACACAAGGCGTATCGAAACCTTCCAGGCAGCTAGAAAGCAGGCAAATATACCATTGCTTTGCGTTTTGA
CAACAAATATATGCAGCAGTTGTGCTTGTGCattgaagtacatgtactcgtgccctctctctcttcctcCACGATCACTGCACACAGGTGACTACTCGCC
CCCCATTTATCCAGGGGGCCAGCCAAGCTTGCGTCCTCCGAGGAGGTGCAGATGCAGGTGGAACACGGACTGGCAGCCGTCCTCTCCGTCGTTGATGACG
ATGCGGAAGCCCTTGTCcaggttctgctgcttggcgacgagcttggcggcgtACAGCAGGTGGCCCAGGACGGCCTCGTGGCGCTCCTCggcgtgcgcga
gctgcgtgagACCGTCGCGCTTTTTGGGGATGAGTAGGATGTGCACGGGCGCCTGCGGGTTGACGTCGTGGAAGGCCAGGCACTGCTCGTCCTCATACGC
GATCTTGGCGGGGATCTGCCCGTTGATGATCTTGTCGAAGATGGTCTCGcccacggaggcggcggcgcccgaGGCGGCCGCAGTGTCGGCCTTGGTGCGT
TCGTCGGAGCTCATGGCGCGGAGCGCGAAGGGGGTTAGCGCGCGGCGCGACAGCGAGGGTCCGGACGCCAGGAAGCtgcggcgaagagctccgatGAGCA
TGCCAATCACGGATTGGCAGCGGGGTATCCATCAAAAGATGGGTACAAGATCAGGCCATTCGCAAGGAAACAAGTTCTCGTGGTTGCCTAGGCTCGCCGA
ATACCCTTTGGACGCTTGGgttggtggcgatggaggatGCAGCTGGCTTCGAGCTTGGCGCTAGTGCTTGTTGCAGTTCCATTGCCGGCATCAAGCCTGT
AGCACTGCTTAACTCCCGATGCACATTCCGGTGCGCCAACTCACCTGCAAGACCGCATGCAACTCGAAAGCGCATGCGCATGTGGTCCGCAAGGTTCTGA
CCAATCCTTACAATCTACAAGTGTAACGCCATAAAAGGAGCAACTTCAATCCTCTGCGCTCGCATCCCCGTCCAATCCGCTCATCGTTTGCGCACCACAC
ATTGCAACGCACTTTGCCCAGATCGCAACGAGAGCCCCGCAGAGCAGCAAGATTTCCCTCTACAGcatgggcagcagcgacaccgtcGAGCCGGCGcagc
cggagcagcaggaagaagcagaggtCGCGGTCGTGGAGGAGCCGACCTTCaccgtgctggtggcgcccCCCACCGCCAAGAGCGGCCAGGCCGTGCGCCT
AGAGAGCGTGAGCCCGTCGGACAccgtggtggcgctgcgccagctcgtcgccgagttTCCGGCGCTCGCCTGCTACACGTGCTACCACCTGGAGGCCAAA
AGCCTCGCGGACGACACCTGGCAGCCGCTCAACgacttcgtggagctcgccGAGTACGAGAACGTGGCGGACGGCGTCACGCTGCGCATGGCGCTCGACA
AGTACGACGCCCGCAAGGCGCGCGCCCAGGTGCGGCGCTTCCGTGACGTCCTGGGCAATCCGCCCATCCCCCAGGCTGCTGTGGAGCCCGAGGCCCAGCC
GGAGGCTGCCGACAAGGTCGAGGAACCTGCGGAGGGCGAGGAGccggacgagaagaagctcaaggagatctCCGAACAGCAGCTGAAGCGTCTGCGCGAG
ATCCACCACAAGCTCGAGGGCATCGAGATCCCCGTCATCCCCGAGCTCGCCGAGTTCTACTCGTTCCCGGGTGCCACCCCTGCCGCGCAGGACGAGACGG
AGCTGACTGCCAAGGGAAAggaccagaagaagaacaagaaggggaagaagaaccagcagaagcaaaagcagcagcaggatgagGCCAACcagcagaagga
gcgcgAAGCGCAGCCGGACGCCAAGCTCCCTGCCTGCGTCAAGAGCATCGTGTTTTCGGGCTACAACCCGCCCCCAGGACCGCGCAAGCTGGCGGGCGAC
CTGCTGTACCTGGAGGTGgtcgtcgctggtgacagCACTCGTTACCATATTACGGCGCACGTCAACGGCTTCTTCGTGAACCGCTCGACGGCCACGAAGT
TCGACCCGCGCCCGCACAAGACTGCTCCAGCCCACTCGCACCTGCTGGTGGATGTGCTGAGCACGGTGTCGCCGAAGTTCAGGGAGGCGTACACTGCGCT
CCTCGCCAAGGCGGCCTCTCTGGCCAAGGAGGGGCCTTCTTCGATCGAGTGGATGGTGGCTGCTGGCTCCAACCTGGGCGGCAAGCTGCCGTGGAACACG
CCTgtcgctgcggcgacggaggagcACACGTATGACCTGAACCGCGCCGAAGACGAGCTTTGCACGGCCTACGGCATGAACGAGCGTGGCGTGTTGCGTG
ACTGGAACGAGGAGTACCAGTGCTGTCGCGAGTTGCCGAAGGAcacgctcaaggaggagatTGTGCGCGCACGTGTCATGTACAAGATCGTGACGGAGTT
TGTGGATGCTGCGACGCAGGGCGCGGTGGCCATCGTTGAGGGGAACATTCCTCCTATCAACCCCATGGATGACAAGAGCGCTCACGTCTATGTTTTCAAC
AACATTTTCTTCTCGGTGTCCATCGACGGCAAGTCTACCgaggacgctgctggaggtgaagAGAACGCCTTCTCGGCTGCCAATCGCGACCTGCAGGGTG
TGAAGGCTTTTAACGAGGCGGATGTGCATGATCTGCACACACTGGCCACGACTGTTGTGGACTACCTTGGTGTCCGCGTTATTGCCCAGAGCCTTATCCC
GGGTATCCTGATGGGAGACGCTGCCTCCAAGCTGGTGTACGGCTCGGTGGACCACGGCAAGACAATTGCTGCCAACAACGCGATGCACAAGCTCATGCTT
GAGGCAGGCGAAAAGCTGCACATCGCCGAGCGTAGCATCAAGCCCCTTGGCAAGAGTGAAGAAGACCTGGCTGCtgagaaggagcagga