Description :
From Genome Similarity Track
Location :
Scaffold_991:867- 5700
Transcript NameFunction/comments
g16584.t1hypothetical protein
g16585.t1hypothetical protein

Sequence
4833 bases(100 bases per row)
GGTGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTCGGGAG
ATTTCAGGCAAATTCTCCCCGTGGTGAAGGGCGGCTCGGCTACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCATAAGGT
GCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCTGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGG
AGACACGAGGTACACAATGATCTGGGAATGACTACATGAAGATTCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGAT
CCGACCGGGAGCTACTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGT
CGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGAATATGTGTCCACAGACTCAGTGG
AGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCC
GACCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACCATC
ATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGC
AGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCA
CGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACG
GCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCGGTTTGCATAGCG
GTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACA
GTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGAGATAAAACATAACCCT
GTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACTAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAG
TCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTG
CCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCTATTATTATAATTCGAGCCCTCTCATTGGCTATTTAGTGGAAGCCTCTGCGCGATTGGCTATTATAAT
GCGTAGAGTGGACTACATCACATCGGAACTAGCCGAATGAAATCGCTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTTCCATT
TTCAAAATGACGCTCCGGCGACGGACCAACTCAACGGAGGACCGGGCGCGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATT
AATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAG
GAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAA
GAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTG
GGGGGCTCCCTTCACCCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATC
CAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACAC
GGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTT
CTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGT
ACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCGCGAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAAATATTA
AAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACC
TCCGTTGCCAAAGGAAGCAACTAAAAGAAAAGAAAACAAAAAAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGT
ATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCTAACGCGGCAAGGCTAATGAGGTG
TTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGCGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTT
GCGAATTGCGAAGTATCGACCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCT
GCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGC
TCAGTGGTCTCTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCACAAGGATATGAGTCTCC
GGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGTCTACAAGAGGCGGCC
GCAGGTGGAGGGGACGTCGTCACAGTTGCAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTG
CTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGAAGAAGTAACATGACCGACTCTCAGCG
GGAGAGTGCGCGGCGGCGTGACGCGGAGCGGAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAACGAAACCGGATCGCA
CAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATCGCA
CTGAAGAGCGCAGGACAGACCGGGAGCAACACGCGGACCGCCGGGTTCAGTTTACGCAGGAGGAGCGTGCTGAAGCGCAAAGGGTAAACCAAGAGCAACA
CGTGGAGCGCCGGTCTCAGCTCACGCAGGAGGAGCGCGCTGAAGAACGCATGGTAAACCAAGAGCAACATGCCCGGCGCCGATCACAGCTCACACAGGAG
GAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCCGAAGATCGCATGATAAACCAAG
AGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCTGAAGAACGGATGGCAAACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTAC
GCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAACAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGA
GAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCATGAGGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGC
GCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAATGAGCTGCTGTCTGGAAGACAAGGTTCGTCT
TCCCCCTTTACGGTCTGCACCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACG
TCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGTGTGTACACGTACCGCATCCAGGGTG
CAATGGGTCACTACTTGGGATCTCTACTCCCCT