Description :
From Genome Similarity Track
Location :
Scaffold_1787:867- 4386
Transcript NameFunction/comments
Phyag_g11475hypothetical protein

Sequence
3519 bases(100 bases per row)
GCCGAGGAGCGTCCTCTTTCTCGTTCCTTCCTGTGTTTACTATGGCCAAGTTTTGCCATGCtctcctgcagctttcgcCAGAACGATCCTTTCTCGCTCG
GTGTGCGCTGCGGGCTATCCGTGCCGATACCAAATTGTTTTGCGCGTGACATTCCTGGACTTGCTGTCCAGCTCTGCGGAGAGTAGCAATAGTCTTCCAA
TAATTTGTCGCTGTAGTAGCATCGTTTCTGCGATGAAATAATCAATGAAGTAAGTCACGGATACACCAAAACTGTATGCAGACCAGTGCACGCACGCAGT
GCCACCCACCTCTTCAAATTTCTCGTACACCAAATTCACAGGAATACCGAGGTAATTCGCTAGGCCGAGCTGTAAACTGTTGAGAACCACAATTGAGAGC
GCCAGAGTTAATCTGCAAGTCATAGAACAACCCCAAGAATCATGCACGCCCTCTACAAATGTCCATACCTCATCTGAACAGGTTGAAGAGATATTTGCCG
TCGAGAAAATGTCGGAGCCGCTTGGGACACGAAAGATACGCCATAGTCGGACTAGATGCATAGTTAGCAAAAAGCACGCTCTCCTTTAGAACACTTTTCG
CGTACTACGGGGATATGTTAGCTTTACCTGTGGCAGGTGTGAAAACTTGACCGAGTGCTCGTACATGTGTCGATACACTGCTTCACCCAGTGATTCCAGT
TCACTACTATTTTCTTCACAGAGATGTCCTCTATTGATGAACAATATCCACTATTGGGTACAACAAAAGCGTTCTGTTAGAATGGTCACATACCATACCA
CCAAGTAGGCTCACAGAAAATTTACCTCGTTGAGGGTTTCTTCAGCCGTAAATTTGTGAATGAAAGGATGTTGAAGTAGTATCTCTGCCGATGGCCGTTG
GTCTGGGTCAATCATAAGGCACTATGCACGCAGAAACAGTCAGTATACACAGTTGTTGCGGAACGAATCGAAGCTCAACATGTAGCGGACCTGGTCAACG
AACGAGCGGCACTCCTCGGAATACAACTCTGCTGGCAGTTTGAGGCATTGCTCATTTGCAACCTGTACGACAAATAATCGTCAGAAAGGCTAACAACAAA
CCAAAAGCCTAAGCGAAAACGCACCGAATCTACCAAGCCAAAGAACCCATCTTGAGTTGGAAGCGGATAACGACCCAAAGCAACAGAAATCAATGCAAGG
CCAAAGGACCAAATATCGGCTACAGCAAAAAAATTAATAGGACCAATTAGCAAGTTTTACTGTATACACATGCAAGAATTGACTCACCTGGGTAGGAATA
ATCGCCACCACCTATCCGTTCAGGGGCCATGTACAGAAGAGTACCCACGAATGTTTTCGTCGTGGTAGAATTATCATTCAGAGTACGCGCCAAACCAAAA
TCCGAAATCTTAACTTCGCCCTGTCGGTTTGTGAGCAAATTGTGCGGCTTGATATCACGATGCACCATTCGCTTGCCGTGAATATGCGCTAAGCCGTGCA
ATACACCAGTTGCTAGTCTCGCTAGAACCTTTTCGTTCTGACAGCCACCGCGCAAAACGATATCTTGCAGAGATCCCGTACTCATGTACTCCATGACCAT
GCAAATGGAGTTTTTGGGGCGGTCGACAAATGCATCGTAGAAGGAGACGATATATGGACTGGGCCTGCGCATAACGAGAACAATTGCTTCGTCAACCTCA
GATTACATCGTCGTTTCCTAAAATGTAACGTACTTTGCTTTGGGCTTGCCTGGGCTTTTTCTTGTAGAAGGATGTTGAGGTATCGGACTATCATTGTCTG
CCATGGGAACGAGGTTTGAATACAGCGCATGGAGCTCACGAACCATTTGCCGACGTTGGCCTCTTCCGTAAACAGGTACATCCTAAATCATGTAATAGAC
AATAAAAATGAGCAAGCACACCCAGTTCAGGACCTCAGAATCACCACACTGACCTTGACTGCGACTACTTTCAGTGTTGGTATATGGATTGCCTTGTATA
CCACACCAGAAGCTCCTCGACCAACTTCTTTTACGCGCTCCAGATTTTCTTGTAAGTGCAGACACGCAGCGTCGGGCGATGAGATCCCCGCTTCTGATAT
AGCTACATTCTTGGTGGTGAACATGCCGTGATTAGGAGAATAAGCACTTCCAGCACTATGTCGCCCGCCTTCTACACCATTCAAACCCCAGTTACAACGA
CGCCGTCATCAAGTTAGCAACTAGCGTCCGAAATCCATGTAAAGCCATGAAATCGCACCGCTTGGAGAATGGAGATCCGAGTCTGACCCTGAACTAAAAT
TCAATTTCATCAGCACCTGCTGAGCAGCGCTAGGGCCACTTGAAGGAGTATTTGACCCAGACgctactgcagctgcaattgcagcggcCTCCATGGCTTC
TCTCTTGGCGATCAGCCGAGTTGCAGCCCGCTGGGCACGCTCTTCAGCTTGCTGAGGTGTAGGCATATCTTCTAGTTTGAGCCGTAATTGAGGCCGCTTG
CCAGCACGATTTCCTGGGGTTCTCTTCGCTGATTCAACAGTTTTCCACTGTGGTGTATCGGTCCGTGGGGTAGATACGGGAGATGTAGTCATCGGAGGCG
GAGTTTCTGCTGATCCTGGCCACTCTGTCTTTTTTGACGGCGATAACGGCCGTGGCCGCTTCTCTTCGAGCGATAGCTGGTTTGTCAGTGAGTCAATTTC
TCTGTCGAGATCCCTTGCCGTGGTGTCCACATTCTCCACCGCGTCATCAACATTAGTATGATGAAATCCATTGCTACTCGCAgttgtcggtgctgcagct
aaTGGTGCCGTCGCTAGCGTATTGACCTTCTCTGATTTTGCATtttgtggcagcagctctcctTTTTCCGCCTGCTTTAACACCATTGTAGGAGCGTCTG
ACTGCGGAGAGACCGGAAAGTCCTTGTCCATCCACGAGCACTCCCACGACTTCACCTCTGCAATCCGCAGCTCTCGCGGACAAATATCCGGGAAGATACG
CGCAATCACTTCGTCATCAGCCTATGTTCAAATATATAAAAGAAGTCATCAACCCATTCTTGACTGCTCTAACAGTGCGAGTCGTACCTGCTCCGTTAGA
TTTGGCATCGACTGCGGTCTCTCCAGTGAGTTCTTATGCACCAGGAATGTCGCATGGTGCGGCGCTCGGCCAGTGCGGAGGACGAAGGGGTTGGCGCTGT
CCACCGTATTGGCgaaggacgagctgttggactgcagcgtcgtgttGGCGGCCTCTCGGTCGCGTCCTTCGTGGTTGCTCCACGTGCTCTGCTCGTAGTT
GGCGCTTTCCACGCGTCCGCGCTTGCGGAATCTCTCCATGAGCGTCTGGCGCGAGACCTCCTGGATGGAGCcgtccagcagatcgcgGCGGTGGCTGGCA
GAGGCCACGGAGGAGGACCCGATTGAcgcaggcggcggcgacgtctCCCGGGCCGCCGCGGGCTTGGATACATggcggttcttcttcttcttgtgctgct
ctggCATCGACCTGGAGGA