Description :
From Genome Similarity Track
Location :
Scaffold_2198:867- 3170
Sequence
2303 bases(100 bases per row)
CGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTTCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCT
TCACAAATGTTTCCTCGAGGATCTGGGGGATGGATCCAGTCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTAC
CACCACTTCGTCTAGTCGGTTCAATGTAGCGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAG
CTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACAATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGG
CCGGGGCCTTGCAGTCAATCTCGCCTCCCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATC
CAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAACCCGTACAACTTTCCATCCGGGCAGTCTCCACAGTATTGCAC
TGTATGCTCCCCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCG
GCGTTTGGGCTCTTTCTTAGGGGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCC
CCTTTCGAACACTTCACTATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCTGACTAGAACAGCCAGGCTA
GCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTTGTAATTCAGATCTTACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACTG
CTCCGTAGTTCAATTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGAACCCGAGCTGCTGAGACTGCCCA
ATCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGT
TGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATTCTCTCTCTGTTGGTACCCGGGTGGATCCAGCT
CCTGTTTCAGGTCCTCTTCTGGCGTCCTAACACTGGGAATCCTTCGTGGATCCCGCATCTCCTGGGGCAGAGCTTGTTGGATTTCATTCTGGACAGCTGG
AGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTTGTTCAAACTGCCC
AAGAAAGATTGCATCGCCCGTAACGACTGTGGGACGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGAT
GGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTTAGTACACGCCTCCAGTAGGGATGTCACTCTCT
CACACAACTGAATCCACGATTCCGCCGGGATTAGGATGTCATCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCTGC
TTCGAATGGATCCACTTCTGCATTCCCTCCCCCGGATTCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGG
TAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGCGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCA
TAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGTTCATTGATTAGAGGCATCGGGTACAC
CATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTTTTGATGATGATTACCACCGGAGATGCCCACGGG
GACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTGAGCGAT
CGG