Description :
From Genome Similarity Track
Location :
Scaffold_3227:867- 2083
Transcript NameFunction/comments
Phyta_totarag15153hypothetical protein PHYSODRAFT_340908

Sequence
1216 bases(100 bases per row)
ATCTCATCATCCAGTATTGCCCCCACCTCGTATTTTTCAGCGTCTCCGCTGGTTTCCCAACTATCTTCAGGTAGGCGTTCTTCGTCAAAATCGAAGTGTT
GGTCTTCCTTCAGCTCATCGACGAGTTTCGCTGTTGGTCTCTTGCCCAGATCGGTTACGGCTTTTAGCCAAGATATGTGGACCACTGGATAGAACTGATA
GCCGCTTTTGTCGGGTAGCTCCAACTCGTACGCAAACTCTTCGACTTTCTGTTTCATTCTGAACGGTCCATGCCATCAGTGAGCtagtttcttcttcaag
ccgGGTTTAACACGCTCCATGAATAGCCAGATTTGGTCTCCTTCCTTGAACGGTGACCTCTGCGGCTCGGCTGGCTCAGCTGAcgagccatcttcatcat
ctgcCGTGTCAGCTGAGTTCGGCACGGCTATCCGCTCCTTCTTACTGAGTCAGGCATTGTGTTCTTCTGCCCGCCGAGCCTTCTCCGTTAGTTGGTACTC
ATTCGCGAGTTGCAGAGCGATTTCTCGCTGACGATTCGTTTACCGGCGCCATTAAGCGCGTCCGCTGAGTTAGCTGAGTCGCCACGGATCGTCGAGGTCA
TAGCCTTGAGAGTCAACTGCGCTTCCCACCCATGTACCAGATAAAAAAAAGAGTCTCCCGCCGAGTTGTGTCCCGTGAGTTGTTAATGGCGTGcgccatc
ttctcgtcgATATCATCCCAGTCAGCTTGTAAGGGTCCTCCACATAGTCTCTAACCGTTTGGATAATTGTTTTGACTGAGTGCTCTTACTGTCCATTAGC
TTGAGGTTGGTAACTCAGTGTAGCCCTCGATCTTGACTGCATCAACTCAGCGAAGGCTTGGAACACCTCGCTCATGAACCGTGGGTCCCGGTCGTGCCGA
ATAAGTGACGGCGCTCCAAGCGGTCGGAAGACGCATTCCTCAAAGACCTTTGCCACGTCTAGTGCCCCAGTGTCACTCATCGCTTTCGCGATCACGTACC
CCGTGAATTGAtcctggaagagcagcagagcagtATTGCCCCGCCGAGTCTTAGGCAACGGGATGACGAAGTTCATCGACACAATTTGAAATGGGCGTTC
CGACACCACATTGCCGGGCGAGTAGCTTCTTAGCTGGGGTTTGCTTTGCTCGTACTACAGTATTCGCACATTTGAACGTGTTTGACCACGTCAGCATACA
AACCCACCCAGTAGAA