Description :
From Genome Similarity Track
Location :
Scaffold_1594:867- 2072
Sequence
1205 bases(100 bases per row)
GCCCTTCTTGGCAAACGGTCGATCACTTCGCTCAGTGTTACGATACACTGGGCGTGAAGCACTACACTTGTAGGTGTCCTAACTTCTGACAGCGATTGCA
CTTATGCAATTGCTTACTGCTTGAAGAACGAGGTCTCTCGCTCTCGACACTGCAGAGGTCAATGGGTTCTGGACCTCCCGCCACTACTCGTCTTGAAGGA
CGATAGGGGTCAAGCTAGTGTGAGCTTGTCTCACACTAAAGTCCTCTTGCACCGCAGTTGTGATCGCTTCCTCGAGCAACGTCAACTCAATGCGGAATAG
GTGATTCCTCACGGTACCATCTATGAGGCCCTGTAAGAATATCGTGATCAACACCAATTCACTTACAGGGTTCGCTACCATGCAACTTGCAAGGTAACGA
ACGTGCTGAGCGTAAGCGTGAACGTCACGCTTACCTTGTTTTATCTTCAGGAGCTCTGGAAGAGTCCTGACTTCAGCTCTTGGCGGCTCGAACGTTTGGC
TGAGCAGAGTCTTAAAGACCGCCAACGATCCAAACACGTTTGGATCGTGTAATTGAAAATTCAGGACCCAAGTTCTGGCACGCCCTGACAAATTCGATTT
GGCAAATGCAACTTGCATTTCTTTGTCTTCGATGTGGCGAGCCTTAATGGCATCGTCCACTTCGAGGAACCATCTCAACAGAGAGACTACCTCGACTACC
CGGTACTTGGACACTTCTAACTTTAGAGTCTCGTGTCGACGCTCACGTGTCGACGATACAGTAGCAGACTGAGACTGTTGCTGTATCAGGAGCTCAGTCT
GCTGGTGACCGTTCTGATGCAGCATGGTCACTTCAGCTCGCGACGCGTCAAGTTCTCGCTGCAAGAACTAGGCGATTACGGATGCTGTTGGTCCCTATCC
CTTGAGGATAGCAGAGACCAGAAAGATCCTTCGCCAGCGGTCAAACTCGTTCGTTCGACCGCACTCCATTCGACATCGCTCAAATAGAAGTAACTTTCAC
GGGTGCCGTGAAAGGTGTCGTCGCCTTCGTCATCCAACATGTTCATGTTGACGGGTTTGTGGTGCTTTGACGGACTACGAAGTGCTACCAGGTGTAACGG
GGCACCGAAGCAACACATTGAACAACCAGTGTGGAGCTACTATCACCAACAGCAGTGTTAGTAGTGCCTCGCTACCTCTTTGCAAACGTGCAGAGGATGG
TGAAC