Description :
From Genome Similarity Track
Location :
Scaffold_157:86679- 93287
Transcript NameFunction/comments
Physo_143906hypothetical protein
Physo_143907hypothetical protein

Sequence
6608 bases(100 bases per row)
ACGGAGGAAAACAACGCATTCATGAGATTGTTGGAGTGCATCAACTCGTCCGGCAATACTGCACTGTGAAGTAACCAACGGGATCGGGAGTCCCGATTGG
ATCATATACGGAACTGATCAGAGATTTGAACAGATTTCCTAAAAGGTGTTCTGGGGGTTGCACCCCCCAGACCCCCGCATAAAGAAAACTAACTCTGAGT
TGCGGCAACGGGTCCGTTCGCTGGAATGCTCGTCGCTGGGCCCGCCTCCGCAAATACAGCGCGGCCCTGCTTCGCGGGCACCCCGCGCGGGTTTGCTATG
GCTACGCTCCTCACAACCGCTCACTACCGTAACATTTGTTTTGTCCCTACAAAAACCAAGATAAGAACCTGTTCCAATCACTGATCAGTTCCGTATATGA
TAAAAAAATCTAGCATCCCGTTGCTTTTGAGTCTACCGCTCAATTGCGGCTCGTTGCCAAAGTTACTCGATCGTGTTCAGAATCTAAGTGGGCAGCAGAA
TCACTTACTGCTGCTGGCACTGCACCGAGAGCTTGTGGACGCGTGGATGTCAAGAGACAAATAGCATTTCGATTATCAGACAACAGCCGAAACGTCTGTC
GTGTAAAAAAGTCTACCTTAGCATGCTAAGAGTTCTTAACTCACTGTGTCTCGCAAGGAAGCATATCAAAACTCGGCAGCTATGTTAGCCCCATCCAGGC
GACAACCAGCTCTTCTTCTTTTTTTTCTTCTTTTTGGTGAGGTACATTACAGTCGTTTAGTCTTGCTAACAACAACCAGCTCTTCGTACAATGCTCTCAT
CAGCGGGTGGTTCTGCTGTCTGCAGAACAAACCGCTGTCCAGCAGGCGACCACAAAACCAGACGCTCATCACGCGGGAGTGCTCGCAACGGTAGGCTTTC
CACCCCGGCAACGCAAAGATCTGGACTCGTCTGCGGGGTGTTTCAACGATTTTGGTGATCCGTGCGCTGTACGAAGCCCCGACATGAAGAGCACGAGCTC
TGAGTTGCCTTCAGAGGTGGTCTACAAAACGCGGCTCTGGATCACTTCGAAAGTACCGTACTAGTTGCTTGATTGCAGCGAAAGATACTGCAAACTCGTT
GCTATGGCTGTACAAGAGAAACAGTGCGCGTCATCGAGCGAATTTCAAGTGGAGAGGGAATGGCTACACGCAGCGAGCAATGGAGATGTCGACCGAATGA
AGGTTCTGCGCGAAAAATGCCCGAAGTGGCTCGACCTTGACCGGGTACGTTAACGTTCTACAAGTTCAAACTGCGCTCATCTGTATTGTGGACTCAGTAC
CGAATGTGCTGTTTCACAGAAGATCGATGTTAATTCGGCGGACCCGCCCGATGAAGCTGAAGTCTTGTGGACCTCGAGATTTTGCAGCTGGGACGGTTTT
CACTTGAGCACCATTGGGGCGTCAGCTCTGCATACAGCTACATGGCACGGAGACAAAAAGATCATGGAGTATCTGCTCGAAGAAGGGCAGGATCCGGATT
CTGGAGGCGACACTGGCATCACGGCTGTCATGCTCGCGGTCATGCGCCATAACCTGCAGGCGACACGCTGTATCTTCCGGGGAAGAGTGGCCATCCAGCG
CAACCTAGTGCTTGACGTACGTCCCTGTATGTTGCATAGTAGATCTCAATGCTCCCACTAACCATCACTTTTGTTACCCTTTCAGTGCCGAGAAGAGGAC
GCAGAGCGTGTGCGGTCTACTCTTGGTCGTATCCAGCTCCTTCTGCGCTTCGGCGCTGATCCGAACAAACGGTGCCACGGCGGCAAGACGGCGCTGCACC
ATGCAACTATGGACGAGGTGTATGAGGTCGCCAAACTGCTAACCGAGAACGGGGCACAACTCGACGCTAAGGACGAGGTACGTGTCTAATTCTTCTGATC
TAACTTACTTTTTCTTACTCAGCACTTGACCCGTGTTTATCGTTGTTGGTTGGTACAACAGGAAGGGGGGTCGCCGCTACACCACTGCATCCAGTCGTCG
AGTCTTCAGGTCGCGAATCTGCTCTTACAGCACGGCACGCAGCTCCGCGTGGCCGACAATGGCGGCGTTACCGCACTTGAGCTCGTCATACGCACCGAAG
ACATCAACATGCTAAGTCATGCTAAACCACCACCAGCTCGTGCCAACTCCTCAGGGGGAGGACTTTGCCGGGTCAGTTCTTATGATCGCTGTCAATGAAG
GAGCGCTGACAGTCGTGGAGTTTCTGCTGGAGGAAGGATACGTCGAGGTGTGCTGTCAAAACGTCAAGGGCGAGACGGCCTTGCATCGCGCGCTGTTGAG
GCAGAAGCCTGAAGTCGCTGAACTGCTGTGCGCTTTAAACGAACAAGCTGACCTATTTGCTCTGCACACACTGGATGGTGAGTCGTGTTTCCACTACCCA
GCACGATACTCGTCACCGGACGAGCTGCAGCTTCTGCTTGCCTACTACCGTCGATGGCACGACCAGAAGCCACTCGACGACGCTGAAGTGTGTGAAGAAA
CAAATATGGTCCTGCTCAACAAGTTGGGCAGCACGGCTCTGTTCATAGCCGCCACCTCAACAACAGACTCGCTTGGCGACCGCAACATGAAGGCGACGCT
GCTTCTGGATGCTGGTGCGAAGATTCTTGGTAGCAATCCGTTTCTCGAGTCGTCGTCCAGCATGGTATTCTCGACGGAAGTGCAGCGATGCTTGAGACTG
TGGCTGTCGGAGTCTGCGGAAGATCACGGAGACCACGTTGTCAGGTTCTGCATCAAGCACCTGGCGATTATCTCGTCGTCGCACTACACCCGGCTCAGGG
TGAACCATGAGGTGCTGGGAGTGTTGCTGTCGTCGGGGTATACAATCGACTCACTGCCGTTGTTGATCGGAGAGCGTCGCCGGTGTTGTTGGAGCACTTC
CACTGATGATTATGTGTGGCCAGCAGAGTTGTTGAACATCCCAACTTATCGCTGCAAGGAGGATAGCATTTCGAGCAATATATATCCATTCCACCCGCGG
CACTTGGATCTAGGCTCACAATTCACCCTTCAGTGGACCGTCGAGGCAAGGTATTGTTAATCCGGTAGGATGGTACAGTATTTCCACGTCTGAATGTGTT
ATCCCACGACAGATTTGACTTAAGTATCTTCTGGTGATCGAATACTCGTACACACGAGTCGTAATAAGTCGTCGAGAGACAGGTCCACTGGATGCGTTGG
GAAGTTCTTCTCTCTGCAACATCGACGGTTTCTGGACGGATCCAATGCTCTTAGGGCAGTTCCCAATTACGTGCGTAATATATAAGGCACACCCGTAGAA
TGAATACTCAACCAAACGAATATCCCGCAGCTTCCCACTCTTAGCCAGACACCACCAAGTCCACGAAGAGGATACGTGCCGTACCGATCGTTCAGTAAGT
TTCCCCACCTCCATCAACAAAACGGTTAATCCGAGATTTCTGTAGACGACTACCACGCATTGGAAACGTTTTCTGGAAACTTGTGATTGGTCTTGCTTTC
AGGATACCGTTCCCTGGGGGGGGGGGGGGGGGGGCTCCAGCGCTACACCGCCGCCGCTGCTTCTTCTTCTGGAGTTTCATCGCCAAGTGACACCACCTCA
CTCACGACCACAGCAACTGCTCTTGAGCTCTGCTCGTCCAGAAACCGATGGCAAATCGTGGCGTGGACGTCCGGGAAGAAGTCGAATGGCGTCAAGTAAA
CTAGATACTATTTCTCGTCTTGTACATGTACACGCCAAGGTTCACAAAACAGAAGACACCCTTCAGTATCATGGACGATGTCGTGCTTGCCTGTCGACTT
GATGTTTCGTTGCTTCCACTCCAATCGTTCGTGGGAGACATTTCGTTTTTGCGAAACACCCAGTCGTTTACCAAAGAGATCAGTCTGTACCAACATTTCC
CTTAGCAAAGTTTGCTCGGCTCCATTCATGCAGTCCGCCGATTTCCGATACATTCCTACCGACCAGTGGCGGTGCACATATCACCCTGAAAATCACCCAA
GGCTGCTTCATGTAGCCACGGGAGCGGACAATCTCGGATATTGATGTCCACGACATAGAAAACTCCAAAATATTGTGTGTGGATAGCGACGATAGAACAG
CGCGGAGAACTTGTGTAGAGCGGAGAAATTGACTGGTAGGGCGTCAGCACACTCACACACCTGTGCATGAAGCCGTAGTCGTCATGTCCACCAGCGCAGG
CGTCAACGCCGGCACTTGGGCAATCTTGATCTGCATCATTGACCAACTGGTACCGAAAAATGGGTAGGTGCATTATCAATTATCACCAAGGTGCATCTTG
ACCTTCGTTGGTCGAGGAGAGGTTTGTGACTTCCTGTCGACTCGAAAGCAATCAACAGAATGAATATTATATTCAACGAGTTGAGGATTTTGCGACCCAG
CGCAACCCTGAAGCTTTAGAGATATCAAGGGCCAACAGAGGTTAGTGTAGTGGATCATTGGTTCAAGCCAGCTTAGACCACCTCGATTTGAAGCTTTCTT
CAACGTGGATTGTATTACGCCACGCACGGCACAAGGAGCGCCGCCGTGGAGCTCCTAGCCTAGACATTCTAGTCAGTCTTCGATTTGCCTCATAGGGCAC
AGACCAACTCTACATCGTGCCTCGTACGTCACCAACAACAATACACTCGGCTCAAAACTTCCAGTAGGCTCGCCACCTGCCCCGCTGAGTGTTCTTATTT
CACCGCCCAAAATTCCGGAAAACATTATAGTTAGCATGGAGGCTGTGAATGCTTCAAATGAAATGAGAAAATTAAAATTCTTGCTAAAAGGATTGAGTTT
CTCAGCGAACCCAAACCAAGTCGGCATTCATTACGGCACGGTCTCCAAAACTGGACGCTTGTCCGATCTCAACTTCTGGTAGTGGGCTCGCTCGACTGCT
GCTCTAAATTTGACTATGATAATAAGAGTCTAATCATAGTTGCGGTCGTGCCGCTTTCCTTGGAGGATAGTCAAGTGAAGTCTATCGCCCTGGCTCCCAG
TCAAAATTTAAAAAATGAAACGATGCAATTCGTGGTGTGTGTATAGTTGCTTCGAGGAATACCCTATTTACTGGCCGACCCGTTTAAACTTTGCCTTGGA
GACCTGGAACCGCCTAGAACGAGGCGCAAACGTCTAATCATAGGCGTATTGTGCCGTTGTTCATGCCCATCGTCGTAAATACGCACGAATTTCATCGTCT
TCTCTATGGCGTCCATAACGTGAACGACCATTTCCCGATTAGCCCACGGTTGTCTGCGTATTTTCGTGAGCACTGATGGTCAAGGTGCATCAGCACAGCA
GAGACAGCGACCGACTCTCGTGGTTGCTGAAGTCCGTAGGCCGCGTCCACAATTCCTTGAGTTTGCACACCCGACTCGCGCATATACTGGCTGATGACCT
GCAGGACGCCTTCGACCCGAATGCCAATGGGATCCAGATCTGGGACCACGTGCTGCTTCTCAGTCTTCTGTTAGAGGCGTTCCTCGTGCCGTACATGCTG
ACTTTCCAGTCCACGTCGCTGGAGATTCTCTCCGTTGCTTTTGCACTGGTCGCTGTATGCGAGGGGGTCTTCTTCGTAGACCTGTACGTGCAAGCGCACA
CGGGGTACTACCAAGGCGGCAACCTCATTCGCGACAAGAAGCTGACGGTGCGGAGATACGTGCTCTCGTTCCAGTTCGTGCTCGACGTCGTCGCCATTCT
ACCGTACCAAGCTCTGATCGTTAGCCACGCGAGCCTAGTACCCAAGCTACTGCTCTTGAAGCTGTTGCGGTTCTCACGGTTTGGAAGTTTCATCAGAAGT
CTGGATGAGTTCTATTCCAAACGCTTCGTCTTGCTCAAGCTCCTCAAGGTGCTTGTGGCGACGGTGTACGTAGCCCACGTACTCGCATGCGCTCGCTATA
GTTTCGGCTTTAGCGTGGACGAGGTCGACCATTGGCAGGCTGAGGACTCGCAACGCACCCACTCTCTCCACGAGCGCTACTTGGGCTCGCTGTTCTGGAG
CGTTGGCATTATGACGGGGCTGTTTGAAGGGGAACTGCCACACCACAGCACCGAGTTCGTGTTCACGATTGTGGTCGCGCTGTGCGGGTTCTCAATGTTC
ACGGCGCTCTGCACGACGATTTTTATCATCTCAAAGTGCGAGAGCGGCCAGAACGAGGCACTGGATTCGCGGATCAACCAACTGATACACGTGCTGTCCT
TCCATCGCGTCCCCGAGGCGCAGCAGACCCCAGCGATCGAATACCTGAAGGTTTGTCTGGTTGTCGACTGATCTTAGGCGGACATTGTCTAACGGTTAAG
CGTGTGTCTTGCAGCGCTACTACAACGATGCGCAGTCGAATGACCGGGAGGCCTCACGACTTCTGTGTCCGTCCATTGCCAGCAACATCCAAGTGGAGCT
TCTCAAGCCCATGATCGCTCGGATGACGGTCTTTAAAGGCTGCAGCGACCAGTTCATCGTCGCAGTCACGGGGCTGTTAGAGATGATCGCGCTGCCGTCG
CAGACGACGCTGTTTTCAGTCGGAGACTATGGCGACGCCCTGTACATCGTCCAATCGGGCGCGCTCGCGATTATCGTGGACTCGGTCACAGTGCGAGACA
TTCGAAAG