Description :
From Genome Similarity Track
Location :
Scaffold_8:86612- 91864
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003856Protein of unknown function
Pytul_DAOMBR144PYU1_G003855Protein of unknown function

Sequence
5252 bases(100 bases per row)
AACTTCCAGACCAGACCGCACATTGGTCCAATGATGCCGCGTAGCCAAGCGCGCTTGAACATGATTGTATCAGGGAAACTGGGGGTTTCCTTCTTCTACA
TTTGAAGTACCTCGTAAGTAGCTGAGGCCAAATACGGCCGAGGATACCTCATATAAAGCGTCGGAATTCCATACTCCGTGAACAATTAGTACAAATTGAA
AGTTGTGAATCTATTAGACGATCGACACACTCATATATATAGCTGCGCATGCAAGTTAGTACGTTCTCTAAGTTTCATATAGTAGCAACTACGTTGTCAA
GATGGCGATTTCCTCGGCCGGAAGTGCCTGTGCTTCGATCACACAGTGCATACAGAACGGCAGCGCCTTTTGCGTCACGCCACCGTCTTGGGTCAGGTCC
ACGATCACCTCGCGCTCGCTCTTGCACTTGCCGCACAGGATGCGCTTGCAGCACTGACACGTGGTGGCAGACCGCTTCAACGCGTTACCGAGGATCTTGA
GACCGCGGAGACACATCTGGCAATGCGTTGCGGTCGCCAGCGTCTGGTTCGTGTACTGGATGTTGTTGCGTCTCCGCTGGTGCGCCATCCACATGAGCTT
CTTGTTGTTGGCGCACTCTATGACGTTCACGCTCACGAGCAACGCTTCAGCGTACAGCAACGCGGCGAGACGATCGGCGATGAAGCCATTCGGGATCACG
AACGCGCGGCAAAAGATCTCGATCGAGTTCTCGTCGTACCGCCGGGTCACGAAGCAGCACGAAAGCTGCATGCGCATCACGCCGTACTGCGTGAGTTGGG
GGATGACCCCGGGCAGCTCGATCGAGTGCATGAGGTTGTACCCTGTGTGGATCTTGCCCTGCTCGTCGCGGAACACGCCTGCGCTCTCGGTGTACACCAT
GTCGCGCCATTTGAGCAGCGCGCCGAGATTCTTAAGCGACCATTTCACACCGAGGAATCGGAACGGATCGTCTTTGGTTGCGTGGCGCAGCGTGGTCAGG
ATCTTGCAATCGTGGTGGAGGTCCTGCGTGTACGTACTACGCAGGCGCCAGACGGCCGGGTTGTCGGCGATGTTGCCGTACGCGGCGTCCTCCATGGTCC
CAGGCACGACGCCCGTCATGACAAACTGCGTCATCTGCTGTTGCTGTGATGGGAGTTCCATCATGACCAGCGAGTCATTGCTATCTATTGAGCCGCGCGT
CATGCTTTGCGACTGCGTCAGGCGGTCGACTTGCATCGTCGCAGCTCGCAGACGATCCAGGACCGACACACCTCCTCTGCTTAATTTCTTAGGAGGCTCA
ACTAGATCCTCCTCGGCGAACGGCGTGTCGGTCTCAAAGCCGCTGCGCGTGCAAAACACGGTGAGCGGACCTCTGGACTTGACGCGACGCCACATGCGCC
GAGGAAACTGGCGGTTCATCGCTCGGTACTCTTCGTAGGCGTTAATCGCTTCCTGGACGAGTCGATCAGCTTCTTCTTCGACCGCTGCGAATTCAACTGG
CGGGAGCTGGACTGGTGGCATAGCCTCGTCGGGTACTTTGCCGTTGACAAGTTTTTGCTTTGGCGGTGGCGCCGCCGATGTGGTTCCAGGAAGCGTTTGA
CTAGGATCGCGTGGCATATTGGCACTGATATCAAGCGAACGATGGTCTTCGACGCTTGTCTTCGCTGCTAGAGGAGGAGAAGTGACTCTCGAGTCACGCA
AAACTGGGAATGCGCGCCTATTTGCAAGCATAATCCGACGCTATCCCTTGCCTCTCTCACAAGCAGACGCGCACACGCAACACAAGACGACAACGTCATC
CTCGAGCATACGAATAGCGGCTCGAGGTTTAACATCAAGTGCGTTACCAACGCGCATCCGGGAGGATCGGAATGGCCACGAAGGCCTTCAAATCCCACGT
TTCGAATCTCGCCGAACATGAGAAGTGATCGCTACTGCATACACGAGGCATTGCCGACACGGAGACACCAAAATAAAAGATCCATCCAAGTTCTGTCCTG
ACTCACCGACAATTTGCAAGTGAGCACTGTCATAAAATAGGATAACAGCCACAGATATGCATGCAAGCAAAACGTCAAAATGGCTACTACTACAGTACGC
CTAAGACTGACCCTGCATCACAGACGCATTTCGCACAGCCCGACTTGTCGACGGCTGTCTCGTTATGTGAGCGCAACACCACGTTCACGCTAACGGCATT
GAGCGGCAGTGACTCAATCCAGGACAGTGGCAAAGGCTAAATGATTTAGCCTTTGCCATTTAGTAAGTGGACCGCGACGTCCGGTTCTCCATGAGGGATC
TGACTGCGGCTTTCCTCATTACTACGACTGTAGTGTTGCTAGAAACGAGTCGAAGCTAAAGGAACTCGGCGATGATCGCCTGGCACGACTCAAAAGCGTG
GAGCTGATACGAACACAACCTCCAATTTTCGAGTCGGACAAAAGGACTATTTCATCACGAAATCCAAAGTCACGTCAGAGCATGATATCGGTAAGAAATT
GAAACGATGATTACTATTCCGAAAATTAAAGAGACACGTGGTATGTTTCGTTTTGTAGAGGGAATCAGAAATTTAGAGGTACATTGTGGCTATGTAATGC
TTTATTAGCTGCTACCTGCACTAACTTTCTAAAATGATACTATTAATTTATATCAATATATACATTATAAAGAATTATTGCCCTTCCTTAGTTCAATTTC
TTTGATAAGCAGCTTCAAAATTTTGTGCGCAGAAGCTCGAAAGAAAGTTGCTGGTTCTGTCGAAATGTTAAACGCACCAAGTCCACCTGAACCTCACTCT
ACGATACTTCATTTAACCAAGATTAAAGCATGCGCAAGGTGCTAGATGGGCAAGGACAGCTTGAGTAACACTCCGGATGAAGATTTGCAATGCAGGCGTT
GGACACGGGTTTTATGCGCAAGTGCATTATCAAAAAAAAATACTCGCCATTAACCCAATTCGGCGCTGATAGATGTGCATGATTCAATACGTGGCTGCTG
CACAGGGTTACGCCAGGGCCAAGGGGTACGGATCATGAGCTTTTAAATTTCGTAGGAGTGCATGATATCTGATACAAAAGCGGCTCGACGAGCATCGATA
TTTGGTACTGGATTGGAGTTTCTCCCATCTCACGATGTGCAACTCCTCCTCATACATGCATGCGAAAACTGAGACGAAAGGACTCGATGCTGTTCGATTT
GGAAGTTGATTCAAAACCTGCTGGTGCAGATTTTGAAGGATGGCGATTAGCAACTTCAGAATCCCAACAAAACGGGATGCTGAAGCATTGACCGAGGAGC
ACATGCACACCTGTTTGCGAGGACAAGTATACAACGTCACACAACGGCAACTGACAAATCAAGCGTACACTGCACACAATGCACTGATAACAGATGACAA
TGGTTGCGAGTGACATCTTAGATGGGGTTCATTAGAGATATCGGAACTTGTTTGTCCGCATGGCCAGTTGTATCTCCGTTATGCAGCAATAAAATTTTCA
GTTAGTAGGATAGTCCTTTATATATGAATCGATTTCTCCGTATGAACCAATACTGCATCATTAAACAGCTTAGCAACAGTTTGAGAGCATGATCGAGCCT
CCACGGTGCCATTGATGATTGAAAAAAAACAGCACGTATCCAAAATCTTCATTTCTTATCTTGTGCATTTTACTCGTCACCACTACGTGGGCAATTTGTG
AGAACAAAGAGCTCTTTGAGGCACGCCAGCTTTTGCAAACTGCGGTCAGCTTGAGTGAAATGGTAGCCGCAAGAGTGACAGAATGCTGTACAATCAAGAC
AGATATTCGCGTGTGGAGGAGATGGTAGGTAGGTTATCTTTAATGTGACGGCGTTGAAATAGATGGAAATGTGTAGTAAGCAAGCAATGGTCCAGATGAT
ATCCCACTTGTCTAAAAGGCCTGTAGTATCTGACAGCAGCGCAGTAAATGAAATGAAATCACTCGAATGAGTGTACAAAGAAACCTATAAAACTACATAT
ATTTGACTTATAGCGACGGAAAGCCCCAATGCAAATGTCGGATCATGGCTCTCGCTCCAGTACTTCATGATTTTCGACATGGTGCTTGTTGAAAAGCCCA
TGCATTCCTTGACATTGTCGCGTACTTTTCATTTCAGCTTTATGCTTGCATTGCTCGAACGTACTCGTAGCGCTTGACCACGAGATATTTTCAGGAGAAG
CAGAGATCACGTGTTTCTGTGCCATTTTGAAAATTAAGCAAGAGAAGATGAAAAGAGTGGGTAACAGGCGAACTCGAACTCGAATTATCCAATACTCCCC
ACTTAAGTACCCTATTTGCGGAGTTATTGCAATAGGTGGATTTAATAGACATTGCTGAGACTACTACTACGCACGAACTTTAGCTACTTTGTAGGTGTTT
AGTGATATTAATAAAAGTGGACCTAGACAAATCGCAGGTGCATCCACTGTGCTTGCAAAAGAATTATCAATACCACCTCATTCATGCTGCGCCGCCAATG
TTGGTGGTCGGTAGCGGCAACTTAGTCAGCGAGAGAGTGGAAATACCCGTCATCTAATAGCATAGTTACCCTCCCACAGTCTCCCACAAGAGCTCTGAGG
GTCAATGCAGTCACTGCTAACTTTGCGTCCATATACAGACAGGTTGGTCATCACTTGGGTTAACTTACTTATTTTCATATTGATGCGCGATTTATACGTG
CGAACGCGCGTAATGCAGTACTAGAAAGTATCACGACGGAATACCACGCATGTGGTAAGAGCTAATACAGGGAAACTTCCCCACGAGGCTCGTTGCCTTT
CTTTCTACCTATTTCTACGTGAAACCAAGGCATTTTCACGGTTACTTTGCCTTGGACCGCGGAATAGCAGCATTATAATTATTGGAGACCACCGCAGCAC
GCGCGACATCGGATGCCGGCAATCGGTTGGCTTCGGAGACGCACTGGAGGCAGAATGGGAACGCTCGCTGGGTCACGCTGTCGACCGCGACGTCGACGAC
GACGTTCGTGTCCAGCGTACACGTCCTGCACACAATTTGCCGGCAGCAGTGGCACGGGTTCGATGGCCGGAAGATACCCCGGAGCTTGCCGCGGAGACTC
TTGTTGCAGAGCCGGCAGTAACGCACTGGCATTTTCGACGTGGCCTCGGACTCATCGAGCAAACTATTTCGAGGGGCTTGCTTCTGCTGGGAGAGCCACA
TGAGCTTTCGGACAAATGCACAATGCAAGAGCGCATCACACGACACAATAAG