Description :
From Genome Similarity Track
Location :
scaffold_6:866- 1989
Transcript NameFunction/comments
Pl_112741prolyl-tRNA synthetase, putative

Sequence
1123 bases(100 bases per row)
GACGAGCCCTTCCTTCGTAAAGCGCTTGCCGACGACAACACGGTATGGGTACCCAATAAGCTCCGATTCAGCCAACTTCGAGCCCGGGCTTTCTCTCCAG
CGGTCGTCAAGCAGTACGTCGTCCCTCACTAGACCGGCCACCTTACCAGAAGCAAGCTGCCCAGCAATTTCCCACGCGGCTAGCGATACGGGATCATCCT
GTTTCTTACTGCCGATAGACATGACGAGAACCTTGTACGGAGCGATCTCTGTAGGCCATGAGATACCGTGGTCATCGTGCGAGGCCTCGACTGCTGCAGC
GACCAACCGACTAACACCAAGGCCATAGCAGCCCATCTCTAGCGGCTGCTTGTTGTTTTTCGCATCGGTGTACGTCGCGCCAAATGGCTTCGAGTACTTC
TGACCCAGGTAGAAAACGTGTCCCACCTCAATTCCGCGCTTGTCCTCAAGAACTGCAGCACCGTCACTGTTGCAGCGCGGGCAGCAGTCACCAGCTTGTG
CCAAACGGAAGTGTCCCCAAGCTAGGTGGGTGTGATCCTGTTGAATTGATATGGTCTCTGCAGCGGAAAGAAGAGCCTTCACCGCTGGGGAAGCGTGCTC
GCCTTGCTTCAGAGAGTCGTCAAGAAGCAAATGCAGCTCTGTGGTCGGGTCACGTTTCGCAAGCAGCTCGGCGATCTTTGTTTTGTTTTTCACAACTTCA
CCTTCATCACCACCGATGAACGGTTTGGCTGTCAGTTCATTCACCTCACGATCGTGACGAGCACAGCACAATGCCATTCTGGGCAGTGAGCTGTCTTCCT
TCTCAGCTGCCTCAGAGTCATAGGCGTCCTCCTGCTCATGCACGAGCTTGACTGAGAATCCCTGCGATCCCGCAATCTCCTGAAGCTCCATGATTGTTTT
CCACATCTGCTCGTCACCTATGCAAATCTGTTCCTCGAGCTGGGTAATGATGGTGCTAAGTTCAACTGAGGTTTCATCACTGTATTCCGTCGGCGTTTCA
CTCCAAGCTGGCAGAAGCCCCTCCGCCTTCTCCACATTAGCTGCATAGTCACACTTCGACGACGAACACGACAAAATCGCATCTTCGCCAACATCCGCCA
GCACGTGGAATTCGTGCGACAGA