Description :
From Genome Similarity Track
Location :
Scaffold_56:86577- 89676
Transcript NameFunction/comments
Hyaar_Emoy2806839hypothetical protein

Sequence
3099 bases(100 bases per row)
TGCATTAGTGCACATCCGATGGAAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAACCGCCAAAACTGGCGAGCGTATCAAGC
TTTTCTTGGTACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTTTTGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTA
ATTGTGCGAGTATTTGTGCAAATACGCCGCTAGACCAAGGAACTTTCGAAGTACTTTCATGTCAGTAGGCACCGGCCAGTCTGTGATCGCCTTGACCTTT
TCCGGATCTGGCCGGACGCCGTGCTTACCCACGATGCATCCAAGAAGTGGTATTCCGCTTGCAGCAAATATACACATCTTGAGGTTGGCATACAACTTAT
GCTCACGCATCAGTGTAAGAACCTTTCGGACGTGGAGTCGGTGGACTTCTACATCCGTCTGTCCATCCATAGCCTGGCTATGGACGAACACGTCATCGAA
ATAGCTAGGTGCGAATTCTCGCACAGATCTCAACAGATACGTAACGCATTTGTTGAATGTAGCAGGGGCATAACTCAGTCCTTGTGGCATTACTAACCAC
TCCCAAAGCATACAGCTTGGAGTGATCACTGCTGTGTAAGGAATGTACTTTTCACGCATAAGGATCTGATAGAACCCGTCCATCAGATCCATCGATGAAA
AGATGTTACTCCTTGCCATACCATCCATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTAC
TACCCGCCATCCTCATGTGGCCTTTCGGACACAAAAGGTCGGAGAGCTATTTGGGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGCGATCGGCAAAT
AATTCGTCAATAGCTAGTACTTGTTCACGAGGCAAAGGCCATTGCTTCATGACACAGTACTTTGAAACTGGTTTCAGGTCGATCTCGTGACGAGTACCCT
TATCATTGGGTAGCTCGCACGGCACTGTTTCTGGGAACACATCTCTGAATTCCGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCAATTCCCACGATTG
GGATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGTTATCAGCAAATACCATTGCCGAC
CGAATATCGGTTACGTACTCGTAATCCGCGACGAGTACGCAAAGCTGCTTGACTTTGCCACTACGCAGATCACGCAAGAGCCTCTTCCGTTTGAGCGTGG
GCAATTGAGTGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATTAAGTTGGTAAGTTCCTATACTTGATCCGTCATTGACTAGGACATTTAATGTCTC
TGTTATCTCCTGGGAACTTATTTCCGCGGTTAGGTGGGGACTTATTCCCTCACTAGCCTCTTGAGCTATATCATCATACGACACGAGTGGAATTGCTCCC
TCGTTATCCTCTGATGGTGGTTGCGCTACCGCGGCCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGCATTGCCAATCATTTGCATCGG
TTCGTTGTCACTTGGGTGTTGTCCGTTTGGAGGACACCCACGCCCCAGTCCACTCGACTTATTCTGGTGGTGGGCCTTCGGCGCGACCTGCATCTCAATG
CAGTCGCCGGAAATCTGGCTTCATAATGTGGCGATCAGCCACTCCATGGTCATGTGCAGTCGTACTGACGACCAAACCACACGCGAGGTCATCGCACTCG
TTCGTAGTACACCCACGTGTTAGTAGGCGCTCCATAGCGTTCATCAGATGGCCATCTGATGAACAAGTGACAGGCATATCGACTGTTCATCGATGCCAAC
TGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTTCAAGGATGACATCAAATTTGTCTTCTAAGTCTAACATGATGAAGTCATCATTATATTGGACTCC
CTTCAGTGTATAGGTGATACCCACTACACGTTTCATCATTGTTACGGATGCGCCTGTCGCGAGGTGCACCGTCATCCTCGTTGGAGGGATCTCTAGCTCA
ACATATACGAGCTCTCCGATGTCCAGTGATTGGCGTCGTACAAAGTTGTTCGATACCCCACAATCGACTAGGGCTCGAAGCGATATGCTTTGTGTCACTT
CGACTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATAACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCGCT
TGACGTTACTGGATCAGTAGGGTACTCCGCACCTACTGACCCTGACCGTTTTTTTTTGGCTGCCCGTTACGTTGTTGCATTTTCACAACAACGTCGGACC
CACGCCTTGGACCTCTCTTGGCCGCTTGGCGTTTACTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCATATGCATAATGCCCTGTATT
TTGACATCTATTGCATTTCTGCAATTTCTTATAGTTGTTAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGTTCCATTGGTTCTGGGCTTCCATTTTCC
TGTCATCTGGATGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATGGCCTCTTCTAGGGTGTTGA
ACTCCAATCAGAACAGGTAGGTTTTAACAGAACCATCAGTCAGACCCTGCATGAACGACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACAGTTATGCA
ACTGGTAAGGTGACGTATGTACTAAATCCACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGC
GGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAATGACCTAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGACCCACGCCTTTGCACGCC
CTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACTAGCCCTTATGGCATCGTCTACTTCCACGGACCATCTCAACAGAG