Description :
From Genome Similarity Track
Location :
Scaffold_539:8657- 10727
Transcript NameFunction/comments
Phyke_g10131hypothetical protein PHYSODRAFT_318067

Sequence
2070 bases(100 bases per row)
ATCGCTGTGAATCCGTACCAATGGCTGGACCTTTATTCCAagcagacgatggagagaTTTAGTGATGGCAAACGCGAACAAAAACCTCCTCACGTGTATG
CTGTTTCTATGGAGGCATTCTTCAATATGCGACAGAAACAGGAAAATCAAAGTATTTTGGTGTCTGGCGAGTCGGGAGCTGGCAAAacggagacgacgaa
gatcGTCATGAGTCACTTGGCGGCTTTGGCCACGAATTCCAATTCCAAggtcatccagcagattaTTCAGGCCAACCCGCTGCTGGAATCCTTTGGCAAT
GCCAAAACTGTTCGCAACGACAATTCCAGTCGATTCGGCAAGTTCACAGAGTTGCAGTTCACGTTGGAGGGACAATTAATTGGCGCCAGGTCACGTACGT
ATTTGCTAGAGAAGAGTCGCGTGACGACACAAGCGGACGGCGAACGCAACTTCCACATATTTTATCAACTGCTGGCGCAGCGCAAGAAGTTCCCGGATCT
TGAGCTGGATATGGTGGACTCGTTCAAGTATGTTTCAATGAGGACAGAAGCCCCTGAcggcgaagaagaaggcgatctCAACCGCACGAGAGAAGCATTG
GAGCTCGTGGGTATTGAACAGCCACTGCAACAGGAGATTTTCCAGATTCTGGgcgctgtgctgcatctcggAGAGACAGCGTTCACCACACGCAATGGCG
ATGTGGACGCCTCGCAGCTGTTGGACCTGAAACACTTTAGTGTGGCTTGTCGTCTTCTAggcgttgaagttgacgcGCTGGAACGTGCCGTATGCAACCG
TAACGTGTTTGTTGGTCGTGAAGTGATTCTGAAACCCATGACGCACGACCAGGCCGCGGACTGCCGCGACGCACTGGCCAAGAGCTTGTACTCGAAGCTT
TTCCTGTGGCTCGTGGAACAGATCAACCAGACCATCGGTGTTAACACTAAGGGCGCTGGATCTTTCATTGGTATTTTGGATATCTTTGGTTTCGAACACT
TCGAGACCAACTCCTTCGAGCAATTTTGCATCAACTACGCTAACGAGAAGCTACAGCAAAAATTCGTGCAGGATGTGCTGAAGACAGTGCAGATTGAgta
tgaagaagaaaataTCTCATGGTCACACATCACTTTCGCAGACAACCAGGATGTGCTGAATCTCATCGAAGGTCGCCTGGGTGTCATCAGTTTTCTGAAC
GAAGAGTCTCTGCTTGCCACGGGTACGGATGCATCGTTCGCGAGCAAGCTAGGTGCCGTGATGGAAAACAACCCACTACTGGAGACTCCGCGACTGAACA
AGTGCGCGTTCTCTATCTACCACTATGCCGGCAAGGTGACCTATGATGCATCGGGCTTCCTCGACAAGCATCGTGACGCAATCTTGCCGGACATCAAGCA
GTGTATGAGCAAGTCCAAATTGCGAATTCTGTCCAAGATGTTCACTGATGATATGAACGCCAGTAACGACAGTGGTGCTGCCTCCTCTGCTCGTGGCAAT
GCACGTGGCAGCGCGCGTAATAGTAAGAAGGGAGGCCATGTCCAAACACGTCGCACAACCGTGGGCACACAATTCAAGGAGAGCTTGTCAcagctcatgg
agaagatcagCCTTACGGAGGTACATTACGTGCGGTGTTTGAAACCTAACGGATTGAAGAGCGCCAACTGCTTCTCGCATAGCGATATTGTAAATCAACT
GCGTTGCGCCGGTGTTATCGAAGCCATCCGAGTGTCTCGCAGTGCGTATCCCAGTCGTATGCCGCACCTTGAGTGCCTGAAGAAATTCCGAGTGCTGCTT
AGCGGTTCACTGCCACCGCATCAGCAAAATAAGTTTATTAGTGACTCGGACACTGAGCAGATTAAGACTCAATGCGAagagctgatggagaagttgctCC
CTGGACGCAACATTCAGGACTACCAGGTGGGCCTGACGCGCGTGTATTTTCGTGAAGGCGttctggaagaactggagacCAAGCGCGGCTGGGCACTGCG
TAAGTACGCCATTGTGTTACAGAAGAATGTGCGCTGCTGGCTTGTACGCCGACAATTCTTGCGGAAGAAA