Description :
From Genome Similarity Track
Location :
contig_58:8650- 10524
Transcript NameFunction/comments
g10851.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCAT
GTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGC
AAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGT
ACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGC
TCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTT
GTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGG
GCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACT
CGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCAT
TGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTG
CAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGT
CGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACT
CCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGG
CGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGT
CGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGA
CACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCT
ACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACG
TGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTAC
AAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTTACTTAAGTTC
AGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGGAAGCTTTGGTGGTAAATGAGA