Description :
From Genome Similarity Track
Location :
Scaffold_3:865- 2596
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001694Similar to tc3a: Transposable element Tc3 transposase (Caenorhabditis elegans)

Sequence
1731 bases(100 bases per row)
CGACTTTATTGATGTTTAACGATTGAAACAAAGCAGCATGCCAAAGAGCATACCTCTCACAGAACTTGAGAGAGGACTGGTCATGGCATACCACAATGAG
AAATTGACCATTCGGAACATTACTGAGAGAATCAACCGTTCATCTACGGTTGTGTATAACTTCTTGCAAGACCCCGACAAGTACGGAACAGCTAAACGCT
CTGGAAGACCTCCAGCGTTGAAGAAGAAAGATAAGAGACAACTGAAAAAACACGCATCTACCGGCGACTTCACTGCAACCCAACTCAAGAAAGTCCTTGA
TTTACAAGTGAGTGTGCGTACAATTCAACGGGAGCTGCAGAAAGATGACAACCTCGTCTACATCAAGGCGAATAAGACACCTAAGTTGACTGACCGGCTG
TATGAGAGCGCTGTTCCAAACAGTCCATCTAACACGGCACACACGCTTGTGCGACGAGGAAGCGATCTCCCGACTTGGAGGGAGTACGGACAACTTGAGA
GCTTGAGAGAAAATTTGCAACTGAATTAAAATGTGGTTATGGTTCCTGTCGCTTCATACAATTGGACCTCAAGGGCTCCTAGAGGCTTTACAACTAAAAC
CTAAACATACAGAAATAAAAACTATGAATCTGATATATAAAACCTTGAGTACACTGAGGTTGGACCTAGGGGATCTGCTGGAAACTTGAACTTGAAGTCT
TGTGGAGATTCCGTGCAAAGTGATTGGCTCCCGCCACTCACTTCAGGTGGTAGAGACACGTCGGTCTCGTCATCAGTGCTGTTTCCCCAAGTAGGAACCA
TCATTCTGTACTTGATTAGTACAGAGAATCTCATGACATCGTCAGGTGATGTCATTCGTACATGTGGGTGCGTATTGCGCGAGCAAAGGCACAGGTCTTT
GTCCACAAAGTACGATTCGAAGGTAGTGTGTGACATACTAATCTGTGACCAGATCCACCTTCATGTAATGGCTAAGTATAGCCCATTACAGGATTATCCT
GATTGGTTATTATTACTGAATAATATCCAATCATATACATCCCTGTAGATAATGATATCTACCAATCACATGTAAGGATAGGGCCCATTACACCCGCGAA
CACGCAAACACTCCTTTTCGTCCTCAATGTGGACAAAAATGAGAACGCGGACTTGTGTAAGCGCTTCGCGAAAACGCCTGCGGAGCAGACTCCATCCGAC
AGCTCGACGCTGACGTTTCAGCCGAAAGTCATAGTCGACCGGCGACACAATTTCGTCAATAGGTCGTCTACGCTTCGCCACTTCTTCGTCTTCTTGTAGA
GATTCCAGGACGATCTCGTCAGGAGGTCGTCTCCGCGGGTTTGGGTCGGGTGTCTCCATCGCGGAATGAAGATCTTTGACACAAAAATTGATGACTGTAC
AAAACCAAGACTTGTATTTGTTCATACAAACTCTATGTGTTTGGGTTATCCGTTATTGTATGCAATAGCTGAAATGATAAGTATTATGAAAGATGGTTAA
TTAATCAAGTAACAGTTCTAACCCTTGTCGCCCCATTTGTGTTGCAGGGGCGAGCAGTTTTGCGCAAGAAATATGCGTTTGGCGAAAAAAAGACGACGTT
GTCTTGCGCGATGAGTTCGAGAGCGTGTTTGTAACTGTGTTCTACTTCAGCGACCAAGATCTGGTGAATGGCCTGAATGCGTTGGCAGTAAGCGCCCACG
CGTGGTCCCAGTCGACGAGATCGTCCCAGAA