Description :
From Genome Similarity Track
Location :
Scaffold_61:86489- 90704
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16957hypothetical protein

Sequence
4215 bases(100 bases per row)
GACCTCAAGACGTTGACCAACCAGGTCTGGATGACGGTGGACGAGTACAGACAGAAGGATCCCAAGATCAGCGAGTCCGAGCTACGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGGTTTCGGTTT
CAGCAACGTGGGGGAACCAATGTACACGCTTCATGAATTCGTCTTCAATACCTAGCAAGACCGACGGTCGTCACACTTTGCTGTTGACGCTCAGAGCAGC
TGTACGTGGCGGTCGGGTAACGACTCGGGAGTCTTGATCGAAGGATGAATGATTCGTTGCGGAACGATGTCTTGAAGTTGTACAGTTTCTTTTTTCTTTT
TGCCCGGATCTGTATGTCATCCCTCTCTAACTCGCAAAGCTGGGCTTGTGCATTGAAAGCGTCGTGTGAACAGCTATTCAGTGACGCGGCCGGCGCTGGC
AAACAGTTTCTGTGATCTCATTGGTGTGTACGTCTCGATTATCGATAGGCGAAAAGCGCTACCGTGCTCACCCTAGACCAGAAACTGTGGCCTGAGCACA
AAAGATCGACAAAGTGAAACTGTATATAATCTAAACAATTTAAACTGTATTAATAAACTATCTATTATTTATATAATAGATAGCTTACAAGTTTAAGGCT
TAGATAAACTGCATTGCCTGTTCGGTCGTAGAAAATCGTTTTTCTATGGGATAGTGATGGTCGAATTGAGATACATGGTGCCCATGAATCGATACAACTC
GTGAACTACAGGGGCCATTTACAATATACTTACATGTTAGTCTCTCCAGTTTTTCTGTACTGCATGCTCTGTTTGTACATGTCATTCCGGTGGTGGAGAC
TAATCATCCGCCAAAGTTAGGTACATTTCTTTTTTAAATTCAAATTAAAATAGTTCATTAAAATTGTTTAACACAGGTAGTATATAGTATGCTTAACATC
ACCACTGACTATTGTGCATTCCTGTATGCTGCTAGCTTGAGGCGATGAATTCAGCTGCTGCACTGGGGACAAAAACATTTAGCGTTATGCTCTGTTACGC
GCTTGGCCACATAAGTGCAGCAAGCACAAAATTCCAATTCAGACTAAACAGAGCTCGCTCCAGCCCCTATACAGTTAAAATGAAGATTATAATACCGGTC
TACATGTATTATATCTTGATTTTTGAAACTCATACCCCACCACCAAATTCACAATCCCCCCCAAGAGTTAATCAATAAACAGTACCACTGAACAGGCCTC
CTCCAGTCGTGTAGATAATGCCACATTTGCGAGGACCAACCTCGTACAGATTTTTGCTTTTGGTATCGTGCCGTGGACACCTCCACAAGAATTTTAAACC
TTCGCACCGCCCAAACGATATCTGTTTGTGCCGAGCAGCGTTCCTAGGAAGCGGGTGGTACGTGATGAGCTGGTACGTCGCACGATGCTGTGTTGAAGCA
GTTCATGTATTCGGTTCAAGACCTCCGTCTTGGTTAGAGGGCTGTAGTACATGTATTGACTTCAGACAGGACACAAGTCCGACCACCAAGACGAACAACC
AGACCCTATTCGATAAATGCTTCCTCCACTCGAGTAGACAAACACCAGCCCTTCGCGCGAGTCGCGAGTTTACTGGGCACAGATTTTCGGCGGAAGTATC
CTCCTCATGGCCTCCTGCCTCGACAATGTTGCCAAAGATGGGTTGAATTACCAACGTGGCGATTAGCAAATCTCATCAGTCAAAAGGAGATCAGTAAAAA
AAAAAGAGAGCAAAATAAAATGGGCTAGTTGGAATGAGTGACTCTTATTACTCATTTAGTAAATGATACTATTATGGAGCTTCGATTCGCTACATATATT
CATGTAGTAAGCCCTCAGCTTCTATCTGAACATATATATTCGAGTATGATTGGACTTGCAGAGGTTGCTTTCATTTCGTGGGGTACGAGCTCTATACAAT
CAGTACGATATCCATATCGCATATCGTGGAAGATCTAAGAAAACGAAAGTACGGCTGCAATGGCAGTGCCGTCAACCGTCTATTGCGATATCGCTTGAGA
TGTTACCCATTTTGCGACTGAAAATGAGCTAAAACATCAAATCCTACGATTGTGAAGGGAAGTGTCAACTACAAAAAGTGCTGATATGGTACACGTCAGC
CAAAAAATGAACCCAGTCAAACTTTGAGAAAGCACGCTGGCAAACCACCCTCGTTTTTACAGATACATGCCGTAATTTTGATGTATTTAGCACAAATGCA
AAAAATGAAAGCACTGTAACGGCACTTCGTGTACATGCTTGCAGCATAATACCCATCACCATTCTTCCTCAAATCGTACTCCTCAACGAGGGAACGAGAC
CTCGACCGGAACCGGGAGGTCAACAGGTACGATAGGATCATTCTGCATTTTGCAACCTCGGACTCACACGCGCTTGAGCAACTTCATCAAACGCTTTCGC
GACCATTTCGATATGATCCGGTCAAGACTATTATTCTTGTTGGCTGCTATTGCAACCACCAGCACACAAGCCATCGATTGGACCTTTTGGAACAATGACG
ACGATTCGACCCCTTCACCCGCGTCGTCCGATACGTCGATATCAGAGACCCTGTCTCCAGAAACACTCAAAAGTATGATGGGGTCGGATTATCTGGACCG
TGTCAAGTCTTTGATTAACTCTGGAAAGGGGTCTGATGTCGGTTCCTCGTCAGGCTCAGCTTCAGAGCCGCCTGCTTCCATAATTTCGTCATCTGCCTCT
TCGGACGATGACTCTGCATCTACTGCTTTGTCACTGTCGGGATCCTCTACTTTGGACTTGCCAATTCCTTCAATGGACGAGATCGCGACTCCTTCNNNNN
NNNNNNNNNNNNNNN