Description :
From Genome Similarity Track
Location :
Scaffold_4:864820- 871367
Sequence
6547 bases(100 bases per row)
ATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGATGCTTCGGCTGCGGGAGGATGGGCCACTTCAAGCGCGACCGTCCCGCGGAAAGCCTCCGCAGAC
GGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGTAGGGAACCAGTAGGGGCGGGCGCCCTACTGGGG
AAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACGCGTCGCAGAAAATCGCACGCCGCCAGACAGCTGCTCGTAATAGCAACAAGTTGTCCGA
TGCTTTAAGAGAAAGCAAGGACAACGGGACGATGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAATGTCCAAGTAGATCTGGTCGTCAAG
GTTAAAGATTTTGACAGCCTCGAACAGTTTACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGACTTGATTAGCACGAGCCCTGGA
TCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGATCATTGGTGAGTCATGTTACCACCTCTGTCAGGACCTGGGGCGCCGG
TGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCCGCGCCCAGAAGA
GGCGTCGGCCAAGTGGGTAGCTTAGGTCCACAATCGGTTAACTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGC
ATAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTTCTGTGTGGGTACCACGGTACCACACGAGGCCACGAG
TGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGACAGCAAAGCTCGACGTCACGGTCGCCGTCGCCAACGACGCCGCCGCCGCCTCAAGCCGTAT
CCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGGTTCGGAGTCTAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGAGG
GCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTT
CCTGGCCAGCCTCAAGGCTGGAGAGATTGCCGAGATGGTGCTCATGAGACCTGAGATCCCTCGGGAGGAGCTGAACGCCTTCTCTGTCTTGGTCGAGAAC
GTCCTGGAAGACCTCAACAAGCAGTGTCAGGCGCGCGTGGGCTCTGAGATCCTTAAGAACTCCAAGAAACTGGTGTATCCTTTGGTGACGGAGTTTGCGG
ACGTCTGAACAATCACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCATGAGATTGATCTCGTGCCTGGCACAACGAATTGTGTCACGAGGCCA
TGGCCTCTCCCGCGCGAACAGTGCAGGGTCATTGACGCCTTCTTCGCCGCGAAAGCGACGGCGGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGC
CGACTTTCTGTGTTCGGAAGCCGAACGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGATCAACGCAACGGTGCCGGTGCCGCCCAAACACCGATC
CCACGAAAAGGATGTGTTGTTAAACTACATGACCGGGAGCGTACTGCACAGTGCGCTGGATCTGGTACCAGATCCTGATGCGAGAGAGTGACATCCCGCT
CACCGCGATAAGCACCCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATACCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAA
CTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATCTTCGTCCATAGCCATGCCGAGGGAGGCAAGACGGCCATGGAGGTGTATCTGG
GACACCTCCGTCGAGTGTTGGACGTTATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGAATAAAGTTCTCGGCTG
CTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGACAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAAAAGGATCTTCGAAAGTGGTTG
GGCTTGGCCAACTACCTTCACAAGTCAGTGCAGGGTACGCGGGCTTCGCTCAGCCCTTGTCGAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAG
GATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGATACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATT
ACGCCATCGGATATGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCATGTTCCAGTCCAGGCAGCTCAAAGCCGTTGAGCGGAACGACCC
TGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTTACCTTCTGGGCTCTCGGCCCCTTCGTGATCTACACAGACCACGT
ATCCTTGAGGACGGCGATTAACTCGCCTCACCTCGCACAAAGGATGGCGAGATGGCTGGGCTTCTTCGCGGAGTATAACTTTCGCGTCGAATACAAGCCG
GGCAAGCTCAACGTGCTTGCGGACGTCTTCTCTCGGCGTCCTGATTATGTGTTGGCAAATTTCACACGGGTGACAACGGATCTATATGATCGGATATGCA
TGGCGTATCGGGACGACGAGGCTGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGACGGATGGCATCCTCTATTACCGAATGGAGCTCAATGCAC
CTCCACGGGTGGTCGTACCCGACGACGAGGATCTGAAGTTTGATATCCTCGCGGAGGCGCACGACGCACCCTTCAGCGGCCACTTGGGCCGCGGGAAGAC
CTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACCCTAAAACATGTGGAGCATGTCAGCGGGTCAAGCCCGCA
GGACACTCTTCGGCTCCGCTACAGAGCCTGCCCGTCCCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGATTCCCGCCGTCGGACACA
GCAACACCGAAATTTTGGTGTTCGTGTGCCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTTACCGTAACGGGCGAACAAACCGCAAGGTTGTT
CGTTTATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGACTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGTCAACGCTGTTTTCTTTAC
TGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGGCGGCCGGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTG
CGCGGCAGCACCACGTACATGGTCGGCGCAATGTTGAGTTTGCGCTTAACAACGCGGTGCACGCGTTCACGGGGCTCACGCCTTTCTACTTGAACGGCTT
CCGTCACCCCAGAGTACCTCTCACTCTTCAAGGAGACACGGACCCCTCTATTCTAAGTGGGGAAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTTTCGGAT
GTGAGGCCAGTTTCTCTGCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCACGGCAGCGGCCCAGGATA
GACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTATATTTAAAGTGGGGGACTTAGTGTTACTAGACACGAAGAACCTACCTCTTGACAC
TGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATTGACCTGCCAAAG
TCAATGACGACGCACCCGACGTTCTATGCTGGACGTCTTAAGCGGTACTTTGATCCGCACGGGGTTGCTGACTCGCAGACCCACCTTGACCCAGCTCCTC
GAAGCGAGGTCCGGTCACAGACTTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGAGCGGCAAGACTGCGGTCAAGACCGTACGCCGGAGAT
GCCCCGTACGAATGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTGGCAACAGAGCCTCGATCCGTCGGATCATG
CGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGAC
GAGCGAGCTCGCCCTGATTCCCAGCGTGGGCGGCATCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTC
CACCTCAGGGCACTGTGTCGGACCCACAGTCGGAGCACTCGGACGAGCGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCC
CCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGTGTAACGGCCTTGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGT
TATGTCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATG
AGTAGTCCGAGGCTTCTTGCCCGAACGGGGTACGGACGTTGACGACACTCCGTACCCCCGCTCATCGTGAGCGCTAGAAGCCGCGCTCTTCAGAATGTCC
CTTGGCAGCATGCGCTTGTTGACCATGTGAGCGAGCGGGACACGAAGATCACGATGGTTCAGGATGCGGGACAGCAGCTGATCTTCATGAAGTTCTCGTA
ACTCCGTGTGTGAGTACTTAAGAGACTCCACCCATGCCCAGAACATGTCCTCACAGGAACACCAGGTAGGACAGTTCTCGGGCATAACCCAGGGGTATCC
CCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAATTCCTTAAGAGGGATGCGGTGTGGCGCCAGAAGCACACACTGAGCA
GTCTCCAAGTTGTCAGCGTACAACTGTTACTTCTGAACAAGGGCATGTTCGTAAATGCCCCTAGAAGTGTGGCCACACACAAGGCCACGAGGAGCGACGA
GAAGCTCTAGGAAGAGGTCAGCCCCAGAGCTCTCTTAGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACTGAGCC
CCCACGCACACGCTGGGCAGCTTGGATATCCTCCTGCTGCTGGTCGAGGTCGTTCTTGACCTTCCGGGGCTCAGAGATAGCACCCTCCTCTTCCTCTTCT
TCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGAGGCCCCGATGGGAGTGCCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAAGCTGTACGTT
TCTTAGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTTGCACGCGCAAGACCCTCGACAAGCGAGAGACGTTTGCAAAGTTTCTCTTCCTCATCGCTAGC
AGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCATAGACGTCCTGGGACTGTGACCACATTGATCACTAGCGAGCGACTGCACGCGG
TCGTCCTTGTGCTCACTGGGCACTGGGATGTGCCCCTCCGCAGAGACCGCAGGAGCATCGTGCGTGATCTCGGACTCGGCTTCGTCCTCACTGCCAGAGT
CGAACTCATGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAGGCAGAGGGCGACGGGCTACGACGCTTGCTTGCTCGCTTGCTCACAGCCGCGTCACC
TGAGGAATCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTAAAGTGCTGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCA
GCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCCTGGTAAACGGTCGAAGTGGAGACCTAGAAGAAGAGCGCACAGACTGCTGCTCGA
GGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGCCCAAGTCGATGGTTTTCGACTTTGAGAATGAAAGTTTGTGACGAACACCTCTTCATTCTG
ATTGGTCGGTAAACCGAAGCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACGTCACACTTCAGAA
GTATGATACGTCATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGACCAAAGCCAGCCATTGGTTGATGACATTACATTACTATAGGTGACTTTTAG
TTTGTATTAAACCCAAGCTTTAATCTACTATAAATATACTCAGTTTA