Description :
From Genome Similarity Track
Location :
Scaffold_146:8648- 12649
Transcript NameFunction/comments
Phyag_g2714hypothetical protein

Sequence
4001 bases(100 bases per row)
CCAAAAAGCACGGGGATGGTAATTTTTCTCGAAGTTCTATAACGACCTCCATCCACAACCACTTGCTTTAGAGTCGAGTATTGGACGCAACTGCACTCCC
GAAGCACGTCCACTGCGTACAAACCTTTGCAGACATCCCATGTCGCGCATCCATTGCCATCGGTCATTACAAGTTGTCGCTCCGAGCTACAATTGTCGGT
GATTTGAAGAGGAATCCCTGCGAGTTTGATGTTCATGTGATGGTTGAAGTAATCCACGAGTTGCAGAGAGTATGTCCACCGATAAACGTCAAGCGGGATC
AGGATTTCTTGAACCGATGATGACGCTGTTGCAGAGCCGCTGTAAAGCCCTGAAGCGGAGATTGTTGGGTAGACAGCGACAAGTGACGTCCACTCGAAGT
AGTCGAGATGAAAAACATAGAGCGAATAGCTGCCAGGAATTAGACGACAATTCGCTCTTCCGTCGCTGTCCGTCACGAATAGCTGCCTTCGGTCTTTGAC
GACTCCACCGGAAGGATCACTCGATTCTTGCTCTTCAGAGGTGATTTGGTTATCTGAAGCACTTGTTTCACCGTTCTCTGACTTCCCTTCTTCTGTGTGG
TTATCCGATGTGAAttgcgtcttcttgtcgctccATTCTTCAAGAACAGCACGTTCATCCATTTCTGGTTTCTCCTCAGACAGTACAGCAATTCCACGCA
GCTGAAGATCGAGTTCTGCCAGCTCTCCTCGCGTTGAATTCTGCAGTAAATTGCGCTCAGATGCCGATAACACTAACGAGTTCGCAAAGAGCCGTTGGAA
TCGACTCGGGAAGTTTTGTGAGTACTCTCGAGCATGATCACTCTTCCGAGCACGCTCAAGGATGCCCCGTTTAATCTTCTCGTAGCGTTGACGCATGGCC
CTCCTTAATAACGCTCGTGCACGAGCAACCGAAATCAACTTCACACTCAGATTagccgccgctgctcgtgttgATGCTTTCGTGATGCAGTCAGCGACAA
ATGCTGCTCCCACCTTTCGCGTGATATCAatcgcgcgcttcttctgtAAGCGGCGTCGAATTGACATGAGTCGAGACCCCATCATCAATGTAGGCAGCAG
GGTCTTCGCCAGATTGGAACTTGGTCCGTCAACAGCCACATTCTTCCCGACGAAAACGTGCACTTTATCGATGGGGACGTTTGTCTGCGCACTCACAACA
CGAAACTCAACGTGCcgcttgttcttcttgttctgtGGAGCAAACGGGTTTTGCTGCAGGCATTCCTTGATTCCATGCTGAGCTAGGATGCGAAGCAGTG
TGCGATAGACGGACTGCATGGTTGGTAGTGTTCGATTTACAGCATTGCTGTGTGTATACACATCGATCTCATtttccacctcctgcagttTTAGTGTTAT
TCGCAATCGAAATTTATACGAGCTAGAATCGCTCAGCGGTACTAGTACGATGCGACCATTTCGACCAAAACGAATATGTTTTGCCAGACGACGAGCAAAT
TCTTCACACTCGCGGTTCGCCGTTGCTGAGTTTTCGTTCTCGTTTCCATTTTCTATAAAATGAACTCGAATTTCATAACTCCGAATAATTCGCAGCTCCG
CAAGTAACACGTTCACTTCGTCGATGCTAGCATAGATAGATGTAGCATTTCCACAGCCTGCGACAGCCTGAAATTGCCACTGGTTGTTCCTCTTTGAGCG
ATaggctgcagctgtcgtAAACCACCGACAAGCTGCGTTCGGTTTTGCATCAAACATGCCTAAATGTTGGTGCTCTTCGACGTTTTCAAGTTGGATTCGC
ACTGCTGATGGCTGGCTTGGTGCTGCGGTGTTAGACTCGTTCTGGTCATTACTTTCGTCTTCTGTGATTCTCTGTAGAGAGAACAAAACACAAAATACCT
TGCTGGATAACGCGGTAAGACGGAGATATACGCGATCCACGAAGGTGTTGCAAATCGACTGGCCTTGACGGTGGGAGATTCCTCCCCGCTTTGTAGCTGG
GCAGCCTTCATGAACGAAGTCAACAAGCTGAAAGTCGTAGTCTACCAGGACGCAGACAAAGCGCCATGGTGATCTTAGCGCGCCATCATCGCACACCACA
GTTGAAGAAATCAGCAGTGTGTTTATAAACGGAAGTGTGTACAACCcagttggcgttggcgtcaGCATCGACAAACTTGGTAGATCATCCAATCGGTGGT
TCTGCGTTCGTGAATAATTGTCCTGGATACGCCTAAGGTAGCTCACGACCTCTTGCAACTCTGTTGGCGCTAAGAAGAAACCAATCTTCTCgaacccagc
agcaactttcCGTtccgtcagcaccagctttCGGTTGATCACCGACTCCATGAACGTTCGCTCCTTACTGTGGCGAGTCTGGCCTGCTAATGCAAACAGA
TGCCGAATTGCTTGGATCTGGATTTCTTCACCTGGAGATCGCTTCGCCTCGAACAAAACGATACTCTCGATCTTCCGTTTAATGTCGTCCACGTTCGGAA
AACATCCAGTAGACTTCATTGAATGCAGAATCACAACAGCGGGGCTTTTACCTGGAGCACGCGTGAGTTCCACCATAATCTCAAAGGAGCCGATGGGTGG
GTGGGATCCATCAGGGTTCACCACAACATTCAGTAGTGGGCTCATTTGCTCGATGCTAGCAACAATGACACTCGATTTTTGCTCGTACTCTGCTTGCGAT
CGGCAAACATGATCGTGACTCCGCTGGATACTAAATTCCGCGGCATACTCAATCAATACACGAATGTCTCCAGACTGCACGGCAGTCAGCAACAGGTTCT
CGAATGATTTTGGGCTTGCAATGGCCCAGTCTCTATGGGCACCGTCGTAAAAGTTTGCCAATAACACAATTGATCCTTTCGTCGCCCCGTAAAGCGGAGC
AGCCACTTGAGAATTCGATGCTCACATAGGAGGAGCACTTAGACGCCAGAAAACATTTCGGTGGACATTCACGACATTTTCAAAACTTGAGTCATCTCGT
ACGCAGCCAACTTCAGGAATTGTCAAAGATATGAGAGGATCTCCCGGAGCAGTGTTACTTTTTCTTCTCAATCGCTGTTGATCACTTGACATCTTCCACA
GCTTGAATGAGGCAATTAGCCCCACGAATCCAATTCTTGCCCGCCAATTGTGAACACTTCTCGCATAGGACGGGTGGCCTCCAACATAAACTGAGTTAGA
GTTTGACGGTGCTTGGGCCCATGCTGAGCTGTCTCCTGCACGCCTTCCACGTACAGACCCACCGTTTGGCATCCTAGAGGTTGGGATAGGATGAACTCTC
GCACAATCTATCAGGTCACTGTCGAAAAAGATCTTGAGATACCGACAATCGAATACAACTTTCAGGTTGACCCAGCGATGGCTAGGAATCTCATAATTGT
TGGCCCAGCACTCCCACCCTCGCCAACAGACTCGACAACCTCCGTCTTCCTCCTTGTCATGAACTCCACGATCATAAATCGAGAACGTGGTTTCGTCGTC
TCCAGAATTCTCGACGCGAAGTTTAGCGGATAGCAATCTCGGTGTCGACTCATTTTGCCCTATTAAAACACAAGAACATAATCCAAGTTAGAATCCGACT
TTCCTCTGAAGTCCTGGCTAAGACTCACTTCTCTTTCGTGTCATCGCGTTTGCGTCGTCAACACTTGCAGAGCAGCCAAAGATACTGCGATTTGTGCTAC
CACAGCACAGCCATCTCACAAACTCCCCCGCATCATCCAGTTCCGGTGTTTTGTGGCGTTCTCCGTCCGATTCTCTAGTTGCAAAAAGGTTCATACATCA
AGTCAATCCCGCGCAATGGAACTAGCAGGCGGCGCAATTCCTTACACTTTTGTCTGTTGCTTTTCCGTGTCAGTAGCCTTAAACAGCAGCATACTGATCG
AAAACCCATTGCTTCCAAGAAGTCGCGAGGCTTCTGTCATTTCCTCCGGTCCACTTGACAACGGGATTTCAAGAAATCCGTCTCCATACAGCGAAATGAC
C