Description :
From Genome Similarity Track
Location :
Scaffold_308:8644- 10533
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_308-fgenesh-gene-0.1Phosphatidate cytidylyltransferase

Sequence
1889 bases(100 bases per row)
CGTGTGGTCGTGGGCTTCGCCATGATCGGCGCGTTCGCGCTCATCCTCTACGGAGGCCACCTCTACGCGTGGCTCATGGTCGTGATCCTGCAGATCCTGC
TATTCCGCGAGCTCGTGAACGTGCGCTATCGCGCCGCCGCGGAGAAGAACATCCCGTGGTTTCGTTCCGTGCAGGTACATTGGGCTATTGATTGCTTGAT
GAATGGTCGGAGCTCATCGTGTGCGGCTACTAACTCACGTGTGTATGTGCTGTTTAATATGTAGTGGGGCTGGTTCTCGGTCGCGCTCTTCTTCAACTAC
GGAGACTCATTTGGCGCGTTCATCGAGAACCGCAAGATCCGCTTCGTGCCACCGATCGTCGTGCACTACTTGCGCTACCACACGTGGATCTCGTTCACCA
TGTACGCCGTGCTCTTCGTCATGTCGGTGCTCAGCCTGAAGAAAGGTACTTGGTGGCGGTAGTCCCATACATGCATGCTGCTTGTTCTCTGTAAAAGTGA
TCCATCTTGAGATGGGAATGCTGAGTGATTTGCGTATTTGGACCTTTGGTGATGAAATGTATCCATGTCGACAGGATACTACAAGTACCAGATGGGTAAG
TGCTTTGCTGTACTATTTGTCGGTGCCCTCTGCTCTGTATAATAACGACGCTAATGGGTATTCAATATTGCTCTGTCAACAGGTCAATATACGTGGACGA
TTGTTACGCTCGGACTCATCGTGTTCCAGATGAAGTACATCCTCAACAACATTTTCAACGGTGCGTCGCTTATAAAGAGATGACAATTGCGATCCTATTC
TACTGTGTGAGGAGCCATACTGACATGACAGTCTCTTCATTGTGGACAACCTGCAGGTCTCTTCTGGTTCGTGTTTCCCGTGTCGCTTGTCGTGTGCAAC
GACTGCTTCGCGTTCTTCTGCGGCAAGCTCTTCGGCCGCAAGTTTGTCAAGACGCCGTTCCTGCGCCTGTCGCCCAACAAGACCTGGGAGGGCTTCATCG
GCGCCTTCATCTGCACGGTCGTGTTCGCGATTTTCTGCAGCGCGTGGCTCGCCAAGGTAAGGATCGATTCGAACCCTCCTATTCTATCCATGTTAACGAG
TGTGTGGGGGTTTGCTCATGATGCGCTGTGTCTCTTCGTATGACTGTTGTTGTTTGGCTAGTTCCAATGGATGATCTGTCCGCTCGAGAGTCTGCAGGTA
AGTGCGCGTCATTTGAATGTTGGCTGGCAAGTGTCGATTGAATGATTGGGGATTTACCTGACTTTGTCTCGTGCTTGCAGCTCATTCCTGACTCGCTCAC
GTGTGCGACGCGCGGCGTGTTCTTGCCGAGCGTGTACGACGTTCCGGCGTCGATCGCCAAGTACATTGGCCGTAGCCAGATCGAGTACCTCCCGATCCAG
GTATGTGTTGCTGTCTGGTCGTGGTTGTGTTCACGTTGTCTGCCATCACGGCTCGTCTGTTGCTCACTCACTCACACATGGGGGTCACTTTATGCTTCTT
TCCCCCCCTGTTTTGTCACAGATCCACTCGATCTGGTTTGCTACTTTTGCGTCGGTGATCGCACCGTTCGGCGGCTTCTACGCGTCGGCGATCAAGCGCA
CGTACAACTTGAAGGACTTCGACTCGGTCATCCCGGGTCACGGCGGCGTCATGGACCGCATGGACTGCCAGTTCATTACGGCGCTCTTTACGTCGGTGTA
CTACAACACGTTCATCCGGTACGACTTGCGTTTGGAGCACCTATCCAGAGAAATGGTGAAAGGCCTTGGTGCTGATAACTCTGTGGTCGTGTTTGTATCA
TGTGAATAGCTCCCCAATGCCGTCGGTCGCCATGGTGGTGAACATTGTGTCGAAGCTCTCGCTCGAAGAGCAGCACGAGATCTTGCAGC