Description :
From Genome Similarity Track
Location :
Scaffold_947:8644- 10133
Transcript NameFunction/comments
Phypl_g11778hypothetical protein PHYSODRAFT_498950

Sequence
1489 bases(100 bases per row)
ggtCGGCCAATCGGTCCTTGAACAATTGCGCTTCCTCCACTTCAAGTCGCGCCAGTTGAGCGTCACGCTGGACCCGCCGGGTTCGTTGTAGCAGCGGACG
CAGAAAGCGCTCGTTGTAGGCCAATGAACGCTGTAGCAGACGCAATTCGGCTGCCAACTGCGGCACTAAAAGCTCGAGATGCTTCAAGTTTCGTGCTGCC
TCctcatcctcttcgtcgtctgtgTCGTTGTCACCACCATGAAGCTCGCCCCCGGTGTCCATGTAGCTTGACAGCAAAGGCAGACGCTCGAAGCAGCTGG
CCATACGTTCGTTGATGAACCCCAACGGGTTGACCCAGGCCGTGAAGCCAGACGCGGGTGTATTCGCAGTGGATGATGAGGTCGCTTCTGTAATCGCCGT
TGACATAAGCTTGCGGAACTTCGAGCGTAGACGGTTTTTGATCTCGATGCGCTCATTCAATTCAATCGCAGCCTCTGACAGCTCGTACGCGATGGCGTAG
CGAACCGACATCGCCGTGGCCTGCGCTTTCTCGGCAGCTTCGATTTTGTGTTGCAGGAAAACCGTGTCACTCGCAACATCCGTATcaaagcgctgcagct
tggaccGGATTAGTTCTAGAGATTTTCTCTGTGCAGCGGCATCGCCATCGTGCTCAAGAGTAGGGAACAGCATTCGATGCTCTTCCGAAAGCGGCGTTTG
CTGTAGACGAAGTCGAAGATACTGTACACATTCAATGACAACCATGGCAACAACTTAGTCTGCTGATCTTCCTGACCAAGAACTGATGTACGAGCTCCTA
CCTCAAGATGACGCTCTTCCTCCAGTTCCTTAAGGCTGGTGCGAGTCACTTTGTAGCTTAgggcacgctgcagcaacatGTCAGGGCTGACGGTTTCTTC
TAGACCCAGCTTTGGGTTCTTTCGGAAAAACTCGCTGCACTGTTCGAGGTCCTTTCATAGGGAGACGTTACGAGCAATAATAATTAGCGCTGGTGCCAAA
CTCGTAGCATTGAAGCATTTCTTACCATGGCGAGAAGCTTTGGTCGCAACTCCGCGGTGATGGCGAGGGCGACTCGATATACAGCTTTCCAGCCATCCAT
TAAGAAGAGGTCCCAAACTCGGACAAGTGTTGGCGTGGCTAGCACACGAGCAAATACCGTCACAAACCACTACCTCGGAAATACAAAGCAGGGGGGGGGA
TTGTAAGTTGCTCAAAGAAGCAAAATAAATCTCGTGGTCGCGATACGAGTTGCTCGGGTTTTGACTTACCTGAGTGACTAGGATGCTGGAATGCATCCCA
ATCTGCCTAAAATGGGCAGATAGATCGTAGAAGTGAAACTTGATAAGTTGTTGAAACAGATAGATGCATTCGGACAGCCTGCGTACATCATCAGACAACG
TGCTCTTTCAGTCTCAGCAGCAAATCCCCACGAAAAACACACGTAAACGCACCTTGGCATCTTGTGTTTCCACAGATCTGCCATCCCCT