Description :
From Genome Similarity Track
Location :
Scaffold_132:8642- 9776
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_132-snap-gene-0.23Phosphatidyl inositol kinase (PIK-B)

Sequence
1134 bases(100 bases per row)
CAAGAGCCGCGAGGTCCATCCGAGTCCATGTCACCGTCGTCTCCGTCTGTGTCATCGTGCTTCCCGCTTTCTCCGGGCAAGATTATCCGGAGCATGAGCA
GGAAGTCGATCGCTCCACCGCCGAGAGATGAAGAGATCACCCAGAACTTTATTCGCTCGAGCGCAGGGTACTGCGTTGCAACGTATGTTCTCGGCATCGG
TGATCGACACAATGACAACATCATGCTACAGAGATCGGGCAAGTTCTTCCACATTGATTTCGGTCATTTTCTGGGCAATTTCAAGTCAAAGCTCGGTGTG
AAGCGCGAGCGAGCTCCATTTGTGTTCACGCCGTCGATGCTGGATGCCATTGGGGGCAAGAAGAGTGAAAATTACGAAATGTTCAAGAAACTCGCGTGTG
ATGCATTCAAAGTGCTGCGCTCGCACTCCAACTTGCTGATCACGCTGCTGGTGCTGGCGTTAACCTGCGGCATCCCGGAGCTTTCGTGCGCGGACGATAT
CAAGTGGGTCCACAAAACGCTCATGATCGAACTGTCGGACGAAGAAGCGGAGAAGCGGTTCCGGAAACTCATCAAGGTCGCGCTCAACGCCAAGACAACG
CAGATCAACGATGCGGTACATCTCATGGCGCATTAAACATGAGCAAGAACAAACCTCATACTTCTACAGCAAGCAGCAAGAGAAAATGAGAAACCGAACA
CTTTAGCAAATGACACAGCAGACGAAACTTCATCGGCACAGAAAATCGAAACACGCGGTCACACATGTTCAACCACAAGCAAAAGACAAAAAACAGTTTA
CGTCACAGAAACACCAAAAGCACCAACAGCACTCTACCAATCAGCATCCCTGCCATTTGTCATAATACTTTTGAAGATGCAGTACTTGATGCAGGCATGT
TTTTGTATCGAGGGTAATCACTTGCTGTTAATGGAAGCAAACCACGCGAGCGACACGAAAGTCCATAACGGATACACTGCCCTAGGTAGGACTCAGAAAG
GACTTCGATTGCGACCATCTCATCTACTACTAGTTGCTGCTGCTGGCGGTAGTTGCATCATAGAATGGGAAATCCGTGTAGCCCTTGCCCCCGAGCGCCA
GGTTGTAATACACTTCCGCGCCAGCGGGTGGATT