Description :
From Genome Similarity Track
Location :
Scaffold_138:86409- 94452
Transcript NameFunction/comments
Phyin_T30-4PITG_20361Putative uncharacterized protein

Sequence
8043 bases(100 bases per row)
GTTTGGCAAGGGTCTTTTCCTGTATGAGTACATCACCGCGTTCAATGTATTGAATCAGACTTCAATTCCACCTAATGCAGCTTTTGATAGCAAGCTCCGT
GGATCAAGTATTACCGCAGATGAATATAAGCCCATACAATTTGTCGGGGGGGGGGCAGCGTCAGCTAGCAAGAACGTCCACTGATGTTCTTCAGTGCTAT
ACAGAAAGCTTAATGAAAACACGCAATGATGAAGCTTGAGTTGCTCTTCATTGTGGAAGTGCTTTGCGAGACCCGAAATGCTTTACTTGGGCACCGTGTT
ATTGTCTACACGAACCACAAGAACTTATCGCTCTCGAACTTTCAGTGATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCGTCGGATTATTCGACGG
TATCACCAATAGCTCAAGCATCCCGGTATGGCAAATCGGACGATCCACCAGCACTTCATCTGGTCGAAAATCAAGCATGCGATTTAAAGGCTCGTTAATC
GCTGCAAAACCTGCCAGAATTGAAAACGGAACATAAATAAAAGATAAATTACCTGCCACAAAGCCTGTGACCCAGACGTGGAAGGTGGTGTGAGTCGACA
AATTCGGTCCTTATACACACCCAAGGCCTGACAAGAAGTTTAGATCATTAGCCACGATTGATTCTGCAACTAGTGGATTTTACGTTGCGTCGGCACCGGA
AAAAGGGAGCAAAAACTACATGGGCAAAGAGTGGTTCTGCAGATACCTGCACCGACAATACTGTATTTCCGGACAAGGCAACGCGTATTCCATTTAACCT
TTAACCCTTTCGTCACCCCCATTAATTTCTATATTAAGCCTTACATACTTTAATCAAGTTAAACTTTCAAAACCGTACATCATGTAGGGTTTTAGTATAT
CAATTGCGAAGGGGTTTGCGAGCTTATTAATCGCATTTGAGAGGGTTTGATCAAAACAGTACATAATGTATGGTTCAGATTGCTGCAATATGATTTGCTG
AAAATAATTGACGGCACTGATGATTCGTCGAAAACACACGAAAATCTTCCTTCTATCCCAACATTGGCACAAGGTGCAGTACCGTGAATGACAGCCTTGC
CACAGTGGAAGAAGGTGGCGATGCTCCATGGAGGCAGAGTGGATCTCGGAGGTCCAATTTGGACCTCACTTCTGAAAAGCTGCGAGCGAGAGGAGTTAGG
AACTGAGCGCAGAGATGGCTGAGCGGGCTTCAAAGCGTCAGCGCAGGTCTCAAGCCAGCAACACACCACAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTCAAACGCATAGAATATCGCTC
TGATAGTTGAGGTGGTTGTTCGTCATAGTAGATAAGTCTTGCTAAGCGGACTTCTAAAAATGCATCATGGATTTGCTTAGGTTAGCTACCGCTGTGCTCT
CCTTAGGATTGACGAGTAGTACTAGCTTCAACAAATGCATCAGTTTCAAACTTATCCGGTAAAGCATACGGCACGTACGGCATCAAACGGTTGGTCTGAC
TTTAGGCGCTCCTGATGTTTCGCCGGTGATTCCTCACCACGCTCTCAACGGAGAGCGCGGGAAACGTAACACGAACGACTTACGTCCGTACTAGCTGTCG
ACGAAGAACCCCTCGAAGGATACCACATGCAACGGTGATGCCACATCATTGTTTGTATATAGGTGACGTAGTCTAGTTCCATCTTGACACGAAGCAGCTG
AATTATAGCGACTTAAACCCGCGTCTTGTTGTGAATGGACAAAAGGCCTTGTAGTGGACGGTCAAAACCCGCGTCAAGTAAGTATAGCGCATTCCGTACC
GGCTACCCAACGTGGTTAGCTTATGCCACTCTGCTGTGGCGTGTTTGGTCGATTGTCTAGTCTATCCTTCTCACTTATATTCCCGTGTATGGATTTCCGT
TCCACAGCGATACACATACCGATATACCGAACCAGGTAACTAAAAGCACAGACCACAAAGGTCACAAAAGCTTCGCGCTTGAGCATTGCCCGCCCCTGCT
CCGCCGCCGCACAATCCGCTTGTGAATATGACGTGTGATGGTTATTAATAGCAACTCCCACGGACAGAAAACATTTCGATGTCCAGTATTTTTGCAAGAT
TTCTTTTAGAGCTTAATCTTCACGGCATGTAGTTTTAAGATCCAGTGTGTTAAAGTATTGTGATTGACCCAGCTCCTTTTGCGAAGCACTAGCGCTTGGC
ATTGGCTGATAATATCTCGTGCTGAGCTAGGGGACTGGGACAACACTCTTGAATTAAATAATCCACACTGTTTCCGCTCTTTGAAAGGAAAATCGACGAT
GTCAAACTCTCTACGTATGCATGTACAGCTAAACTTTAATCGTACGCCACATCGTGTTCACCGTACCGAACGTATGCTTGCATCCTTAACTTAAAAAGCG
CAACAATTGTGATAAGCTCACAAGACGCTATGACAAAAGGATCGCTATTCGTAATGTTTTCATGCATGTAAATAATCATCTCCTGCTGCCGTTGCAAAGC
TGCAGCATCTGCTCTATACACTACCAAAGACCTGCTGCCGATCGCTCCTATTTGTTATTGTCAGCCTGCTCACTCATGCTCGCACGACTCTCTCACTGCT
GCGCGGGTCTCGTATGCTCTCCGTTTGGTGTGTGTTTTAAACGTTTAGAGAAAGCGAACCATAAGTAGCAGGGATCTTCACATAAATCGAAACCGGTCGC
TTGACCAGGTCATATTGACGGCGTCAACCAACATGAAACTTTTGAACTCATTTTACGTTACCCAGAATATACGATATTTTTGCAACCTATCGATTATTTG
CAACTAGTGGTTTATAAAAAGTCTGCAGCACTAACAATATTAATCTCTGGCCTTACTCAAATGGTACAAGCTGTAGTTTTTTTGCAAAAGAAGGTGAATG
GACATCCCAGCTGTTACTGAAACTAAGATGTTTTCATCAACCCTACCGCAATCTGGTACTCTGCAATTCTGCGAACTAGATCTTAATTCGGCCAATCGTA
AGGGAATAAACATCAACAAAGAAACGAACTATTGCCTCCCACGTATCTCTAAGTATTGTGTCTCCATTCCTTTCACACGACAAGCTCGCGCTAATGAGAA
AGGACCGACAGGTGTTGCGTGCGAGCGATATTAATCGCTTCTTTCTTCTCATGTGGCGGGTGCTAAGGCACGCTAGTAGGCGATACCGACAGATGCTGCG
TGCGAGCGATAGAGATCGCCTCTTTCTTCTCGTGAGGCGGGTGTCAGGGTACAATACATAGCTCGGAGATTTTCGATGATCAGCGAGGCTCGAACCTTTG
CGGATATCAGCGAGGCTTGCACTCTTCACGACTGAAAGGTACACTAAGATGGACTTGACAAGATCGGTTGGCTCCATACCAACGCCGATTTGTCATTCCA
TTGCATCGGAAGGCTGGTTGCGCGTCTGCACAATTATTTACTGACTGTTTAATCGATGAACCTTTTCATTGCAGCCTCGAGGAGCAGCCACCTGTTCGAA
ATGGAGAACGAGGCGCTGCCGATGCCTTAAAGTTTTGACCGTGTGCAATTCATGTAAATGCCGCTTAGCGTATCCTTACGATAACGTTCAAAGCACTGAT
AGCGCTAACTAGATTGCAGTGGCGCGCCCAGATTAAGACCGCTTTGGCCGTCGTATTTCCTGTTGTCAGTGCGATGTTATGGTGGAATACGACGACGACG
ACAAGGATGATGAATAGGTGCAGCGATCATGGAAAGCTGGCTGCTTTGGCTCGCTTTCCTTGATACGGAGCCAGATTCTACGAATCGCAGACGATGGTAT
GCTACTAGCAAAATTTGCTCAGGATTCCGAAATGTATGCTATAAGAGCTCGGTTAGTCGCCGCTGAGGAAAGGCGACGCGTAATGCATGTGGAGATATTG
CTTAGTATTCTATAATAAATGTTTAGAAAAAAAGCATTGCTAACGCGAAGAACTCCTACGTAACTGTGCTGTTCGATGGTTGTGATGTGCAATTGGTGCT
TGCAGGCCTTCGCTCTTTCCACTCCCTTAAAGCTGTGGATTGGGCTTTATAAATCGGAGAACTTCTCTTCAAGTTACCGTCAACTGTGTAAAGACCCTTG
GAAAAGTAGAAAAATGAACTTTTTGCCAGCAAGACCACCGCTTTTCCTGACACAGGTGAGACTTCGCAGGGTCCACTGGATATTCGCGCTTGCAGAGAGC
GACATGGTGCGTCTCGCAGTAGTCGTTTTTTTTTTGTCGCCTTCCGACACTCAAACTTGCAAATGGAGCATTCTCGCATTGAGCCTGCTCCTTCCATATA
GCAAAATGCACGACTCCCGAGAGACACACGTCTGTGGGTGGACTGCGTCTACTGATAGCTTACTCGCATCGGTTCGAGTGACATTTGCTTGAGCTGTTGC
CGAACTGGGCGTACTCGCTGCATACACAATTCCAGCTTCTCTATCAATCCATTTCTTCCAAGAACCATTGACTAACTCACGCACAAGAGATACGAAGAAC
GCTCGGTGCCGGTCACGACAGGCCGGTGTGGGGTTGGCGGCACAGGTCTGTGAGGCGTCATCGCTCGTTGGGCTCTTACCGCGCGCTAATTCGTCGCATA
TACACGCGTTGCACTTGGCAATATCAATAATTGCCATAGCTAGTTTTTTATGCCACTTCTTGACAGGGTGGCCTCCGGCGAGAGAGAACCTTCCACGTAG
TTGGTCGTGGCGGTCGACGCGTTGCATTGCTGAGTTATATTCACTAACACAGGTCGGAGCTTTAAATGCTTCTGTAATGGATCGAGCAGTCGAGTGGACC
ACATGGCTGCAAAGTCAGGTGATGAGTAGCAGTACACGTGGAATGCGAACGACGGGTTTTGCATGGATGATGAGAGGGAGGTGGACGATGTGTGAGCGTG
CCGGCTGGCGACCAAGGTCGTGAAGCCAGCCGGGAACGATGGGTTCCTCGCACACCGTGAGTGCAGTAGTCAAAGAGGTGATTGGTAGCACGAGTGGGAT
ACGACGCCAGTAGGAAGGACGAAAGAGGCCGACATGAGTGTGCTGACTAGTGGTCAGGCTCATGGGAGCCGAAACGAAGGACGGAAGAGGCCGACGTGAG
TGTGCTGGCTAGGTGGCCAGGCTCATGGGAGCCGAAACGAAGGACGAAAGAGGCCAACGTGAGTGTGCTGGCTAGGTGGCCAGGCTCATGAAAGCCGAAA
TGGATGATGAGGAATAGTGGGGTGGGCTATGTTGAAGTACCGCGCAGCAGCCGCACTGCAATGAACAAAGGAGGAGAGCAGTGTGGGACGAAGCTCACTT
TTGGATCTGCGGCATTAGCACAGGACCTGACACGTGTGTGGCGGAAGACGCACTTTGGAGACGAAAGAGGGAACGAGGACCGGCAGACGAAGGCCGTCCG
AGTCACCGAAACGGAAGAGCGAGCGAGCAGGGAGGGGCGGAGGCCGACCAGCTAGCGAGCAAACTACAGCCAGCGGAGCACGTGCCGACCGTGCGGGCAG
CGCCGACGATAGGAGGGCGTAACAAGGGGCTGAAAGGCACCTGAGGCCTGTGTGAGGAGTCGGGTGGCGCTCGGTGCGGGGAACGCACGGGCGACGAAGT
AGCGCAGCGGCGTAAAAGGCTAGTGCTTGGAATAGTACACGAGGGTGAGTAGGAGCGAGTAGTGCAGCAATGGTTGTGTTGCGTAAATATAAAATAGGAA
CGGACACTTCTCAGTGGACGTTCCGGCGCAGGACCGAGTGGGTTCTGTCGGCCAGTGGAGTGAGGAAGTTCCGTACGGGCGGCGACTAACCAGGGCGAAC
CCCCAGCGCAGTACTTGTGGAAGCAGTGCGACCTGCCCCACGGCCGGACAAGATAATTGGCCCGTTACATGGTGGTCATACAGGGGCGTAAAGCAAGCAA
TCGACAAGCATTACGAGACGAGATGGCGGCCACGAAGACAGCAACGACTAAGGGGTCCAGGGTAAAGACCAGGATCTCACCACGCTACGCGAAGAGCCAG
ATACTGGTTCATGAGGAGGAGAAGTCGCGAGAAACCTTTAGTGAGAACGTGGAGGGCGAGGGCGACCGTGCGGAGCAGCAGGAAGAGGTTACACGAGAAG
AATCGGCGGCGGGACGCACGGTAACGCTAGTAGAGTCGACGAAGGAGAACAGCAGGACCCGACAGACTCGTGACGACGCTGAACTTGTCGCAGATGGTGA
CGAAGATACTCCGACGGGTGGCGGAGCGGCGAGCCAATCGGCGGTAGTTACGATGGCCGAGACCATTAGCGAGCTGCGAGAGATGGTGGCTAGGTTGCAG
CCGGCTCCGGTGGACGCCGGACACGAGGAGCGGCGGTCGGAACGTCAGAGGAGCCGGGATGCTCCAAGGCACCGGCGCAGCTCTGGTCGCTCGAGACGTT
CCGGACAACGTTCAAGTAGAGGCGACGACTCAGGAGACGCTAGCGATCAGCGAAGGCGAGTGTCGGCGCGTCGGTCGGTGCGCGGAAGGTCATCCAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGGAAGAAGCAATCGCAG
CAGTTCGGCCCAGTGGGCGGCGGACCGAAAGGGACGGCACCAGCGAGAACGGGACTCAAGCGGTGACGACTCGGACGTACAACCCGTGAAGAAGAAGACG
AAGGCGGCAGTGAGGCATTTGAAGGGGAGTGACGGCGGCGCCGCGGCGGCGGGGGCACCCCAGGGAGGTGGTGCTGTTGTTTGTTTCGGCTGTGGGCAAC
CCGGACATATCAGGCCACACTACCCGAACCCACCCCAGTGCTT