Description :
From Genome Similarity Track
Location :
Scaffold_950:864- 2483
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_950-abinit-gene-0.13Myosin

Sequence
1619 bases(100 bases per row)
ATCCTTGTGAGTGGCGAGAGTGGTGCCGGGAAAACGGAAAGCACAAAGTTCGTGATGCAGTACTTGGCGACGATCTCTCAAGCGCAGAAGGGCTCTGAAG
ACGATGGAAACGTGATGAAGCAAGTCTTGTCGTCCAACCCGATTTTGGAGTCCTTCGGTAACGCCAGAACAATCCGCAATGACAACAGTAGTCGTTTCGG
TAAGTTCATCAAGATGCAGTTCTCTGAGCGCGGCAACTTGATCGGCGCTTCTATCCAGACGTACCTGCTCGAAAAAGTCCGACTGGCGTACCAAGCAGAA
TCCGAGCGCAACTACCATATTTTCTATGAGATCATTGCTGGTGCGTCGAGCGAGGAGAAGGAGCGATGGAAGCTGATGGCTCCGACAGAGTTTCATTACC
TGAATCAAAGCACGTGCGTCAAACGAAAAGACGGTGTCGATGATGCAGAGCAGTTCAGTGTCCTGAAAAACGCGATGCAGGTCATGGGTTTCAATGAAGA
GATTATGGAGAGCATTTTCGTGACGATCTCGGCCCTTTTGCACCTTGGTAACCTTGAGTTTGATGAGAAGCAACTGGAATCTGGTACGGAAGGATCCACT
ATCTCGGATTCTTGTGAAGAATCGATGCAAGTGGTTCTGAACTACCTTGAAATCGACAAAGCGGGACTCGAAGAAGCAATCTGTAGCCGAAAAATCCAAG
CGAAGGATGAAACGTACACGATTAGCTTGCTTCCTGACGCCGCGGAAAACACTCGTGACGCTCTCGCACGCTTCATTTACGGGAAGTTGTTCGACTGGTT
AGTCAGTCGAATCAACGAGATTGTGGAATGCGACCAAAAAAGTACCTCTTTCATCGGTCTACTGGATATTTTCGGTTTTGAAGACCTGGAGCACAACTCC
TTCGAGCAGTTGTGCATTAACTATGCGAACGAAACTCTGCAGCAGCACTTCAATCTTACCGTTTTGCGCTTGGAACAAGAGACATACGAGCGAGAGCAGA
TCAAGTGGAGCTTCATCAACTTTCCGGATAACAGCGCTTGCATTGACTTGATTCAAGGCAAGCCGTTCGGTATCTTGAATGGCTTAGATGAAGAGTGCAT
CGTTCCTCAGGGAAATGACCGCAATTTTGCCCGGAAAATGTATCGTCAGCACGACGCGCATGCGCATTTCAGTGCTGATAAGACGCAGCAAGCCAACCAT
CATTTCGTGATTCACCACTACGCCGGAAAAGTGTCGTATGATACGTTTGGCTTTTGCGAGAAGAACAAGGATGTGCTGTACCCAGAACTCACGAATGTGA
TCAAACGATCGTCCAAACCATTCGTGCGCAGTTTGCTCAAACTCACTGAAGGTAGACGCGTGTCAGCCCCAAAGAAGCCTCAAGGAATCTTGAAAGGCAG
AGCTGGAAGTGTTGCGGGCCGGGTCAGTTTGGGATCTCAATTTCGCAACCAGCTGAAGGAGTTAATTGAAACGGTAAGCGTGACAAGCTGCCACTACGTG
CGGTGTCTTAAGCCAAACGATGTTGCAAAGCCTACCATTTTCAACTCGAAGCGCATTTGTGATCAGCTCAAGGCAGGCGGAGTGTTGGAAGCTGTTCGAG
TCAACCGAGCTGGTTATCC