Description :
From Genome Similarity Track
Location :
Scaffold_166:8639- 11567
Transcript NameFunction/comments
Phymu_g5891hypothetical protein PHYSODRAFT_472163

Sequence
2928 bases(100 bases per row)
GTTATCTTCTGAGTTGTCGTAGTCATCAAAGCCCAGCACCTTATCAGCGAAGCTCAAAGCTGTGTATTGTGGATCCATCGACAATCCACCGGCCCCATCA
CCTGTAGCAAGCAATGCGGCTAAACAGCTACGTaactcttcttcactcaTAGGCTCACCCGACTGCAACAGGCGAGCTTCAAGCTGACCCCATTGTAATG
TTGAtggttcttcgtcttcgtcatcaccgaggctttttgctgctgaagcgatAATCTTGAAAGCATGTTCGATCTGCGCTTTACCAACTCCGAAGACGGG
CCGATGGTTCACGTACAGCTTGATGAAATCATGAAGACCAATACTCTCGACTGGGCGAGACGTCTCGGTAAAACGTGAATAGCGGACCTCACTTACCATG
TGCTGAATCTCCTCGTCTGTAGGATAAAAGCCCAGTGCACGCATCACGTTTGATATCTCGCGCAGCGGAATTTGAGCTGTTATTTCGCGGGCGGCAGTGG
AATCCTCGCCCTGAACACGAAGTTGAGCTAAGTAGAAGTAGTCGATGATTTCGTGGTAAAATGATCCCTCTCGTCCACCTTCCAGCAGTGCTAGGTATGG
CGCAAGAGCCACATCGTCctcatccagttcgtcctccaccactttcTCTTCGCCAAGCTCACTCACGGCCTCCTCCTTAACAGTTCGAGGCGTGCCTCGA
GCCTCCAGTAAATCTAGTTGGTGAGTGTGAATCTCCCACATATTCACCACAAGATCATCTCCACCTGCAGTGAGCAAATGACTGCCGTCGAACGTCACAT
CCACGTTGCTGATCTTGCCTGGGTGTGCTATGAGACCCATGGCCCGGTGTGGATTGCCATCGAGAGGAAGCTTGAGTAGTCCTACAACCTTTTCATGAGT
ACTGTAGACACAGTATCGCTCAGGAACACCACCTGTAGCCTCTGCAGTCATTTGATCGACTTCTCGAAGCGGTACTGCCACCAATTTGTTAATTGGTCCA
CCGTAAGAAGGACCCAGCGTCGTTTTCCGGCAAGTCTGGTTGCCAGTATTCCACTGCTTGAGCTTATACTCGTCATTCGCCACGATAACCAAATCTTCCT
GCACACCGCGTAGTTCAGGGTGCCAACAACAAGCAGTGGGGACAGCGCTTTGCTCTACACGCGTAGGAGCTTGTTTAAGCACCACACCATCCAGGATACT
CGATCGCTCAAGGCAATACTCAGCTAGAGTGCGATCCTCGCTCACAGAAACGAGAACTGGTTGTCCATCGCCATCGCGAGAGAACTGAAGACCAGTTATT
GGCTTTGAATGAGCTCGACATCGTCCCAGATACACCCACTCATCAACATCATCTGAGCCGTCGGGGTGAGCTGTCACTTGCTTTGCACGCCACATACCCA
GGAAAAGGTTCGCGTCTAACGCTACGAATAGCGATGAGTCAGGACTAACTAATACATCGGTGATGGCAGCTTTCCCAAGACGAAACGAAGCTAAATCATC
CAGCCGATGTGCATGAAGCACTTTCACAGCACCGCTGGTAAACCCGACTACCAGTTTTCGACCATCACGAGCAAACGTCAGACATTGCGGACGGAGCTTC
TCCGAATCGAATCGTCGGACCATGATCAGACGCTTAGCCGAGTAGTCCCAAAGCTGTACGACTCCAGAATATGAACTAAGTGCAAGCTGTGCGAGTCTTG
GATGCGCAGCAAGCCCATGAATGGAGTCATTTATTCCTTGCATAAGTAGTGTACCGCGTCGTCGGTCAGGTTCGTGCTCTCCAAACAACGTCGCACTCAT
ACCAACGATGAAAGCAGACGCTGTCGATACAATGAAGTCGGGAACATGAAAAGACTCgctgtcggcttcgtccCCCATACGTGTGCCATCATTATGATTG
TTATCGCCGGTTGTAGCTCCCGCTGGTAAAGCAAATGACACACTGGTGACAGGGCCAGCATTCATATCCTCGAACCAAGCCACTAAACGGAAGTCAAAGT
CATAAAATCGCACTGCACCATCACTGGAGCCTAGAACGAGATAGCCATCCATATCCACGACCACAGTCAGAGCCACCTTGCGCTGCGGTTCAGCTCCGCC
TGCAAGACGTACAATCTTGACAGCCTTGCGCTCTGGAAAACTGCCAGCAGGAACCTCAACATCATTCTCACTTTGTACTGCGTCCCAAAGCACAAGATCT
CCATCTTCGGTCCCAGTCAGAGCTTGAGCCGAGTCTGGAACAAACAGAGACTGCGTGAAACCACCAACAACTTGGCGGAAGTCTTTTTGTGCTAGCGAAG
GAGAGTAGAATAGTAGTGTGCGAGCTGCCCAGCTCCAGAAAATCACACGTTGACGACCCGTAGTGACTAGTTCTCGAACGTCGTACGTATTGAAGCGAAC
TCCGTGCTGCACGTCTTCTGTCGCCACGAGTGACGAGTACAATGGCTTCGAGACTGAgccagttgctggagctgcccatTCCCAAACTGCCAGCTCTTGA
TCAAATCGCTTTCGAGCTGTTGTCTTGTTCATCCCGGACCCATTAATACTTTCATCATCACGATCAACAGCACTCAACGTAACGAGAAAGAGTGCGTCGG
GTGAAATGTCGATGGCTTGAACACCGTTCGCGTGCGGCCGAAAGATGGTCCGGATGGGGTTGCCGGACTGAGCGTCCCACACAACAAGCATCGACTCTTG
ACCGCGATCAGCCGTGACAACCCAGCGTTTGTCTTCGCTGACAACACAGCATGAAATGGGGTGACAATGTCCTTGCAGCAGACGTTGCTGACGGCGAGCA
TAGTCATATATAACACCCGTGTGTGCTGCAGCATAGAACACAGCACGTCGTGTTCCTGTTGATAAACTGTGGACGCCATTAATCAGGTCTTTCTGAAAGC
CGAATGCCCAAGCCAGCTTCAGTGCATT