Description :
From Genome Similarity Track
Location :
scaffold_76:86369- 87828
Transcript NameFunction/comments
g2880.t1 hypothetical protein PHYSODRAFT_286035

Sequence
1459 bases(100 bases per row)
CTGCACTGCTCCCTTCTCCTCTCGGTCTTGGGTCGGATCCGTTTCTTCCGTTTGGGCTTCGTTTCGGAAGGACTTAGCGACTGCGGCTCAGCACTCGCAC
GTGCAGGAGAGGCAGACGTCTTGGAATTCTCAATGAATTTAGTGAGCGGAACTAACACAGGCAGACGCTCAGCTTGTGTGTCTGCAGGTCGCGTGAAGAC
GGAGGCGAGGCGTCTGCCGTCTCGCTGTCCGTCCTTTGCCGGTAGGAGAGATGGTAGCCTACCCGGACCGGTTTTAAGCTCGAAGCTGTGGCTGAATTCG
CCCATTGATGCCGAGGAAGGAGGCGGGCGCGGAGTGCAGGTGCGATGCTTGTTGGTAGTCAAGAAATAAGGGCCAACAGGCCAACAGGTTATCCACATCC
CTCGGGTTGCGACGCATACCCTCTGTAATATGATATCGTGTGCTATCAACATATAAAGGTATGTAAACAATTGAAACATAAAACCGATTGTGATGACTTC
CTAATGACACATAAACGGGTTGTATTCATCAGCATCATCAATCAAAAATCAAAATCAACATGCATGTACATGTACATTTTTGGTGGGGCTACACTGCATG
AAGGCATGCCATGCCCTACACAGTGCATTGTATGTACTGTCGTCCTTTTTGGCAAAGACGGTGGCGAGTCAATTTCTGATAGCTTCCGGTTGAAGCGGGA
TAACCCGGTTGTTTCTGCTAACAGCGACTCGATTAACTGTCCAGCCGAGCCGTGGCACAAAAGCCTGTGACCAGAAGATTACACGACCAGTTTGGTTGAC
GCAAGTTCACGATCGAGGGATGTCGTCGCCTGGATGGGACCAGGTCTCTGCAGTAACTACTGTACACTACCGTGTACAGTCACGCTGACTAAAGTGCATG
AATAGTGAGCCGCCAGGAGTGTCCTACGCTGCTGACAACGCTACAGTAGGCTGGCGGCCAGGCTGGCCTGCCGTCTTGAGCTCGCAAGATCTGATCACAT
TGAAACGGGCCCTCTTGATCAGCGTGAGGTGAGGTTGCTGCTGGGTGTAGCGATGCTATCGTCACTAACTTCGCTGGCTACAGCAATGATACTTTGGCTA
CACCACCGACATTCTTCGTACTTCGAAGTAGCTTCCTGATGTGCACATGGTAGTTCAGATGATTAACTTGTTTTTCCTGGTTATTCTATTGGCTGGGTGA
ATTCCCCGAGGGCGTGTACATCAAACGCTCACTCAGGTACTTTGGCTTCGACGGTGTCTGGTACCTGTCGTTCACGATTTAATGCTGAGGCTATTCTTTG
GAGACCTCATTGTCGGATCAAGGCTCTTCTTCATGCTTACTAGCAATCCGAATGCACAACTTTGTGTCCGGGACGGCTGCGATTCAATTGAAACATTGGA
ACATTGTTTTCTCACTTGTCCGGCGCTAACGCAAATGTGGCGAACACTGTGGAGTCAAT