Description :
From Genome Similarity Track
Location :
Scaffold_25:86353- 89706
Sequence
3353 bases(100 bases per row)
CGAGACATTGAATATCTTGGTTAATGACGGGTCAAGTGTAGGCGATTATATACTTGATCTGATCGCACCTCCGAAGTCGACTTCGTAGATTACTCAATTG
CCAACGCTAGGACCGAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGTGTTCTCGTCGTGGAGGACGAGTACGTGACTGACATTC
GGCCGGCAGTATTATTTGCAGAGAACGAACGGGTTCTCAGCAGCTCACCAATGGACGAAAGTGTCCTCGATGATAAGACTCGGATTGAAAGATACACGTC
TCAATCTTGGGAGTCGCTTCAGGCAAATCCTATATATAAGGATTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGCCTGAGGAT
AAAGTCAATAGATATGAAATCAAGCTCAAACCGGGCTCGAAGTAGGGTGTCATGAAGCAGTGGCCACTGCCTCGTGAACAAGACTTGCGATCGACAAGTT
CTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAACTTCCCCTCACAGCTCTCCGACATTCTGTGTGCGCAAGGCCACAGGAGGATGGCGGATA
GTGCACGCATTCAACAAGTTGAATGCTGCAACGGTACCGGCTAAGACGCTGATACCGAGGAAGGACGTACTCATTGATGGTATGTCAACGAGTACCATCT
TTTCGTCCATGGATCTGATGGATGGCTTCTATCAGATCCTAATGCGTGAACGGGACATCCCGTACGCGGCAGTAAGCACCCCGAGTGGCATTCTCTGGGA
GTGGCCAGTAATGCCACAAGGGCTTAGTAACACCCCTACCACCTTCAACAGATGTGTTGCATATCTGTTGAGACCGGTGCAAGACTTCGCGCCGAGTTAC
TTCGACAATGCATTCGTCCATAGCCGGGCTCTGGACGAATAGGCGGACGTAGAAGTTCATAGAACTCACGTTCGTCAGGTTCTTACACTTATGCGCAAGC
ATAAGCTGTACGCCAACCTCAAGAATTGTATATTAGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACGCTCTGATCGTGA
AACTATCAAGGCGATTACCGACTGGCCTGTGCCAGTCGAAGTTAAGGGACTAGAAAATTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCACGCAACT
ATGCTGAAATGACCGTTCATCTCTCTCGTCTCTTGAAAAGAACGAGGAATGGTCATGGAACGCTGATTGTCAGAGCTCCTTTGAAGGTATCAAGCAGAGC
TTGATGCAATCGCCCATCTTGGCAATTGTACAACAAGACAGACCATTCCATGTGTTCTGTGACGCCAGCGATTTCGCAATCGGCTGCGCGTTAATGCAGT
ACGATGCAGACGGCGCAGAGCGTGTCGTCTGTTATCAATCGCGTCAGCTGCAAGCGGCTGAGCGTAATTATCCAGTGCTGACAAGGAACGCCTTGCCATG
AAGTATGCACTAGCAAAGTTTCGCGTCTATCTCGTTGAAGATAGGCCGTTTGTAGTCTATACGGACCATGCGTCATTATGCACGGCCGTGAACAGCCCAC
ACTTCTCGCAAAAAGGATGGCGATGTGGCTGTACTTCTTTGAGAAGTACAACTTTCCCGTAGAGTACAAACTCAGACGACTTAATGTCGCTGCGGACGCG
TTGTCGCGCCGACCCGATTTTGAGTCGGCTGCGCAGTCCAACAGTGAGGTTGATATCCCTGTGGCAACACTAGTCACTAGTGTTTCGTTGTCAACATTGC
TTGACGACAGAAAAAGGCCTATGCAGAAGATAAGACTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCTCGTAAATCTCTCAAATATTACCGGCGT
TGTATCGATCTTCCGCGGATCGATACACAACACGCAACGAGTTACTGCATTATACAGCCGTTACAGGCGACGCACCTCGTGTCGTCGTCCCCACTTATAA
TGATTTGCTCTTACGTATCATGTATGAGTGTCACGATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGAATTTTAC
TGGGCCCGCCAGTATCAGTTTGTGCGCAAGTACATTCGTGTTTGTGAAGTGTGCAAACGGGTGAAGCCCAGTCATTTATCCCGTGCGCCACTACAGCCTC
TACAAATCCCGGAAGAGTGCTGGCAGTCCGTTTCAATGGACTTCGTCTTAGGTTTCCCCGAAGACGCTCAGAATAATAATGGTATTCTTGTGTTCATAGA
CCGTTTCAGCAAGATGGTACATCTCGCCGCAGTTAATGAGTCAATCTCAGCACATGGTGTGCCTGTGTCTTCATTGACACGGTATTCCGGCTCCACGGTC
TACCCCGTGAACTTGTCTGAAAGAGATCCTCGGTTCACGGCGGCGTTTTAGCAATCCGTGTTCCGATCCCTCGGACCACGTCTGACTATGTCTACTTCTG
ACCATCCCGAGACTAATGGTCAAACAGAACGCGTCAACCGCGTCCTCAAAGAAATACTTCGAGGATACGTCCAATCTTTCACAGATTGGAGCGAATTTTG
CCGATGAAGGAGTTTGCAATCAACAACCTTGTGCATGCATCGACAACGCATACACTATTTTTCGTGAACGGCTTACGCCACCCACGCCTACCCACCCAGT
TAGAGTGTGACACCAATTCAAGGGGGGAGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTGTCAAGGCAATCGACGAAGCGAACGTT
GCCGATATCGATCAAGTCGACATCGAAGAAGATAACCTTTTCAATAGTGATGACACTATTGCTGACACAGATGAGGATGACGATGCTGGTATAATTAGCA
TCGCCAATGATTACACCAGCGAGGATGATAACACCCTCGCTGAAGAAGAGAATGACCTCCTAGCGGTGCGCACAAGACGCACTGCAACAAACCAAAGTGA
TGCAGCAGAAGGTTTCCTGCTGGCAAGAGAAGCAGTGGTCCGTTTCGTGCAAGACTCCATCGCTAACGCGGTGGTGGACCGGCAGAAACGAAACGCTGAC
AAACATGGAAGAGCAAACGTTCTTCTATTTAATGTCGAGACTTAGTTATACTGTCTACGGTTAATCTACCTAAGCACGTAGTAACTAATGTGGGTTGTAG
TAAACTACTACCTAAGTACATCGACCCGTTCCGTGTGCTACGTCGCAAAGGCAATGCGTACACAATCGAGTTCCCTCGCAGGATGCGTACGCATCCTACG
TTTTATGTCGGTCGTCTTCACCCGTACCATCACCACGAGGTCTCTTCCTCGGG