Description :
From Genome Similarity Track
Location :
Scaffold_33:86352- 111118
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13455signal recognition particle receptor subunit alpha
Phypa_INRA-310PPTG_13456adenosine deaminase-like protein
Phypa_INRA-310PPTG_13457hypothetical protein
Phypa_INRA-310PPTG_13458hypothetical protein
Phypa_INRA-310PPTG_13459protein kinase
Phypa_INRA-310PPTG_13460hypothetical protein
Phypa_INRA-310PPTG_13461hypothetical protein
Phypa_INRA-310PPTG_13462hypothetical protein
Phypa_INRA-310PPTG_13463hypothetical protein
Phypa_INRA-310PPTG_13464hypothetical protein
Phypa_INRA-310PPTG_13465histidinol-phosphate aminotransferase
Phypa_INRA-310PPTG_13466hypothetical protein
Phypa_INRA-310PPTG_13467hypothetical protein
Phypa_INRA-310PPTG_13468hypothetical protein
Phypa_INRA-310PPTG_13469hypothetical protein

Sequence
24766 bases(100 bases per row)
GTAACGACAACGTACCCTTGTCATCAATCGTGTCAAACTTCGTGATGACAATGCCGTCAATGCGGTGCGGTTCACGGCGGTCCGAGTAGTCAGCAAGAGC
CTAGCACAACAGAATTCACAAGGTTAGGCCTAGATCAAGCAGCATTAGCGAGCTTCAAGAGACTTACCCGGTCAAACATCGAAAGCTGGTCGATGCCATC
GTTGCCCACCAACGCTTCTCCGACAAAGAGAACCAGATCGGGTTCGTTGTTGGATACCAGCTTGGCCAGCGCACGCATAAGCGGCTCGTTATTTTGCATA
CGTCCAGCAGTATCAATCAGCACACAGTCGTAGCCGTTTTCCGTGCCATACTTGATAGCCTCCTTGGCCACCGAAGCGGGATCCTTCGCGTAGCCCTTCT
GGAACAGCTCCACGTCCAGAACCTTGGCGTGCTGGTTCAATTGTTCCACAGCTCCAGATCGGAACGTATCGCAAGCAGCAATCATGACGTTCACGCCCTT
CGACTTGAGATAGTAGCACACCTTGGACAGGCTGGTGGACTTACCAACACCATTCACACCCACGAACACAATGCTGTAAGCACGGCCCTCGGACTTAGCC
TGCAGAATCTCACGCAGCACGTCGGTGGACTTTTTCGGTGTCAAGATACGCAGCAGTGCAGCCTCCAAAGCCTTGCGCACGACAGTGGAGATGCGCGTAA
AGCTCTCGAGTCTCTGGCCGACCACAGTGGTAATGACAGACTCGCAAAGCTCATCGGCGACTTCCGAGGCCACATTCTTGCTGATCAGCTGCAAAAAAGA
AGACGACCACGTGTTAGTACTTTACACATGACAGAGATATGTAGTTAGAATAGAGCCAACCATTTGGTGCATCGGGGTGATCACGGGCTCCAAGTCTTCT
CGCTCAAGGATCTTGTTGCCAGACACCGTGCTCAGGAAGTTACCCAGACGCGTCTTGGAAAAGCTCCAGCCCTGGCTTGACTCGGATTCTGCTCCAGACG
AAGCTGCTGACTCATCGTCGGTGTCAGAGAATTCTTCCGAGTCGCTATCTTCCATTTCCTACACGAAGTCACACGAATAGCGCAGAGTGGCATTAGGATG
TAGCGTAGGTGGATGTCAACCAGGAAAAGTTCCTTACTCCAATGTAGGCTTCACGCTTCTCGCGGAGCTGCGCTTCTTCCTCCTCGGCAGTGATCTGACG
ATATCGTTTAACACACAAATCGATCAGCAAGCCCACTCAGTTGCAGCCACTCATTCACAGTAGCTCAGGTACCGTTTTGGATCGATCCAAGGCCTCGGCC
TCCTTCTTGGAGACCTTCGTGTCGTCCCATTTTGTCATCTTCTTGCCGCTCTTCTTGGGCTCCTTCGCGGCCTTATCTTTGCCCTTACGACGCGGACCCG
TGCGCATCTCGCGCACTTTCGAGCGCAAAGCTGCTTCGTTCTCCAGCTCCTCCAGGCTCTTGTCCTTCCCGTCAGACGTAAGGCTATCACTGCCATCTTC
ACTAGACTGCTCCAATAATACACAAAATCAAAATATTATCTAATAAAACGCACCCATAAGTTGCAATAACAGCTGAGAAAGAAGCATACATCCACAGTCG
TGGCGGAACGCGATGACGACGCCGTCTTGCCCGAAGTATTGGACACCACGCCCTTAGCTTTGGCCTTCTTGGACGCATTGAACGCGCGCGGTCCCTTGCG
TGCTTGTTTCTCGGTAAACTTAAGTTCCGTGGCCTTGAGGATCTTGGTGAACTTGTCTTCGTATTTGACGGGCGTCTTGTTGGCGATCTGCTGCGGGAAC
ATGGCGATGAAGTCCTTCTTGACAATCTCCAGCAGCTCTTCAATGTACAGCAGCTGAAGGATCTTCTGGTAGACCACCACAAAGACCAAGTCGAGCTTGT
TCTCAAACACCCACTGCATGGCGTACGCGTCGTCGATGAACTTCTTCTCGCCGGAGCGGTCCTCCATGAGCACGCGGTTGATGAGGTTGTCCACTGGGTC
GCCACCCAGCTTACACAGTGTGCGCGACCACAGCACCGTACCGGTCTTGGAGAAGATGACGAAGTGGTCGATCATGACGAGATGAAGAGGGATATAATAG
ACACAGGGCTCGGTGGGTTTGGTTGTGGCGGCTCTGTTACCTTTGTTGTGTCACTTCTTTGAAAAAGTGACCGTGGAATGAAACCGGTCTCTTTGGTGAG
ACCACACCAAGTGTGCACCACATCATACCGTTCGATGGACTTATTGGGTCCGATAGATGACAAGCTTGCGGCGTACTGCAGGGCGCTGCCCAAGGTGGAG
CTGCACGCACACATCCATGGGTCTATTCGGCCGTCAACTTTGAAGGAGCTCTTACAGGACGAAGCAAAGCGGAATGGTACGGAGCCGCTGCGACTTCCGA
AGAACCGCAGTCTGGACGAGTGTTTCGAGATGTTTGGGTTGATCCACCAAGTAGTCACTAGTCGACGCGTACTTCGCCGGATTGTCATTGAGGCGGTGGA
GGACTTTGCCGCAGAGAACGTCAAGTATCTAGAATTGCGCTCCACGCCGCGTGATTTGCCGAGGGATGGCGCGACCCGTGCAGATTACGTGGGCGAAGTG
GTGTCAGCGCTCCAAGAAAGTCACGCGCGACAAGATCTGGACATCGAGGTACGACTGCTGCTAAGCATCAACCGGAACCAACCGCTGCAGTTGGCGGAAG
ACACCGTGAACATGGCGCTCAAGCGCAAGAACGAGCAGAATTGTCCGTTCATTGTGGGTATCGACCTCAGCGGAAACTCAGAGCGCCCGAATTCCGAATT
CTACCGCTTCGAGCACGTGTTGGAGCGCGCGCGAGCCGGAGGCCTCAAGCTCGCCGTGCACTTTGCCGAACACTTCGACGACGACGAATCCACTCGGATC
CTGAATTTCCGACCGGACCGACTAGGTCACGCCTGTTGCCTACCGGAACCGCTCTACTCCAAGATGCTGGCGCTGCGAATCCCCGTCGAGGTCTGTTTGA
CCTCCAACGTCCATACATTGGACAGATACCGCAACGATGGAGACTGTAAGTGTTCCTTGGATGAGAAGCACGAGGCCTCGGGGCTGTGCGTGTGCGGCTT
CACCTCGCACCCGCACGGTAGGCTTCTCGCCAACGATCGCGACCAGGAGCAGCAACTTGGCGTCTACCCCATGTGTATCTGTACGGATGACTACGGCGTG
CTGGACACCACGCTATCGATCGAGTACATGCGCATTGCGCAGGCGTTCAAATTGGGCAAGGAGCGACTTCTAGATATCGCCCGATCACCCATAGAGGCAA
TCTTCGACCAGAGCCAAGTGTCCAAATTGAGGCTGTTATTCCACTGAATTCCGGCGTTGGACATCTGAGGTCTGATTTGCGTCATCCCTGGGACTAAAAA
TCGACACCAAGGACAATAAACGCTGAATGCTCGTCACAATTGCTTCAGACAGCTAACCATCAATCCATGGCGCCACGAGCTTACCTACCTGTTGTCGTCC
TCCTCCTTCTTGTCGTTGCCGACGTTTCGATGTGTTCAGCCTTTGCCGCGTCGAACGGAACAGAGGCAGCCACTGTGTATGACATTCCGGAGTGTACCCA
AGATCAGCTGAATCTCGGTGAAGCAATCCTTACCACGGAGCCCAGCACACTGCAGTGTGAGAAGAAGTTCGGCATCAAGTCCGGCATGCTCCTGCAGTCA
GCCGACGCCGCAGATGAGTTCTGCGCAGAGCAGGCCTGTCTCAACGCACTGCGGACGCTGTTCTCCACGCTACCCAATTGCCGCTACGAATTATGGGGAC
TCAAGTATTCGGCTACAAAGTTCCTCAACCACTGCGGCTTCTCCACGGACATCGCATAATAATAACAAACATCAAACACTGGGTTAGGCACAGATGTGTC
GACCGCTCCACTAACACATAGAGGCACGCCATCTGTGGACACACAATTTAAGTCTAAAAAGTGAGTAAAAAGTGTTTCCGACTCTCCCTTGTTCACTATC
AAATATTCCACGGACCTCTCTAGTCGCCACTGCAATGCGCACTTTCACGCCTGTCCTGCTTGTGGCTACTGTCGCCGCCGTTGCCTCCGCGCAGTCCAGC
TCTGGCACGACAACGACTGCCTCGCTGTCGTCTGCATCGGGCTCAGGATCGGCGTCCATGTCGGCAGAGCTCGCGGCCATCTCCGAGTGCAACAGCACTC
AGTTGGACGCGGGCGAGGCCATTCTAACGTCGAACCAGCGCGCAGAGCAGTGTGAGGAGGCCCTGAGCTTGCAATCCGGCACAATGCTGCAGGTGACGAC
CGCCGACGCCACCGAGATGTGCGACACAGCGTCCTGCAAGGCCGCCCTACAGGAGCTGTACAACGAGCTGCCTAACTGCCGCTACAACCTCTGGGGTCTA
CAATATTCGGCCAAGAAACTGCTAGAGTACTGCGGCATCACGCCTACCAACTCGACCGACTCGGACTCCAGCAGCGGCTCCGTCGGCTGGAGCGTCAACT
CGGGTTCGGCCTCGTTCGCACCCGCAGGAGCTACGGATGCCCCCTCCACGGCCAGCAGCACAACTGGTGACAGCTCTGCTGGATCCAGTGCTGCTACTAC
TACGACCGCTGTCTCGACCATGTTGGCAGCTACCGTGAGCCTCATCGCTGCTTACTTGGCCTAAGCCTTCAAGTCATAGGGAAATCGTGACTGACACAGC
GTGCTCTCTTGCTCCTTCGTTTCTCGTCAAGCAATTGTTTCGTGTTTGCAACGAGCTGGTTTTTGAGGTTAGTCCACATTTTAAAAATGAATTCTTCTTT
TATCTTGGGTTTCTCTTGCCAGTTCAATTTTATATTTGAAAGCACGGTAAGGAGAGAAGAAAATGTATGCTGTGAGGTCTTACCGCTGCATCTCGTCGTT
GAGGAGCTCTTCAGTAAACTCGAGTGCATCCAAGACTGACGGTCGCTCCTCGGGGTTTGTGTGTAGCATGTCACGAATGAAGTCACAGAACTCGGCCGTA
AATTGTGTGCCGCGATGGTGCACGACGCCGCCTTGCTCTGGTGGGAATGACACTCGGCCGTTTAAACATGCCAGCTTCATAAAGCCCTGGGCATTTCAAA
ACAATAGAATCGTGAGAAGGCATGCAAAAGCAGCGACGTGGTAAGTGAATAGAGCACATACCTCTCGCGGGTGCTCAAATGGACTTGTTCCAAATGCCAT
CGTATAACTGCACGATAGTACAGTCGTAGTTAGAGCCTTGTCCACAGAACATTAGTCGCAGAAAACATTACAAGATACTTACAGTACACAACCAAGAGAC
CATACGTCCGACTGACCGTCCAGCGCGACGTCAACCGTTGGCTCGAAAAGTTCCGGTGCGCGATAAGGAGCTGAGCTCTTGCGGTTTGCTTCATCTTGCA
ACTCGAGCGAATTCCGACGTGAATTGACTTCTACACGAATCGGAGCACAGCTACCAAAGTCTGTCACCACCGGTATGTAGGCAAGGAAATCCTCGCCGCT
GAACGACGAGGACAGCAGGATGTTGTGAGGCTTGATGTCTCTGTGGCAAAAGCCCGATCGGTGCAGAGCAAGCACGCCTGAGCAAATGCCATGAAAAAGA
TGAAGTGCTGTCCGCTGCGTAAACGGCCATAAAGGCGACGATGACTGGCACGCGGCATTAATCGCATCCCACAAACTTCCGCGTTCGAAATACGGGACCA
AAAAGTAAAACTAAAACGGGCAAAGAGCAAAAACGATCGTTAGGTACAGGAAGCGATAGATATCAAGGTCAACACAAACCAGTTATTCGTACCTCCATTC
CCTGTTGAACTCGTGCTTCAGAAAACTCCACAAGTGGCATGATGTTTAGGTGCTTGACGGACTGGAAATCCAAACCATAACAAGTATTAGTCATGATCTT
ACAAAACAAAGTTTTCACATCATAAGGTACGTACACGGAAGACTTGGAGCTCCATCTGCACGTCATTTTCAACCTCCTGGGACTGGCAGAGGATTCGTTT
AAGCGCAAAAGTTTCGTTGGTGGCTGACGACCGAACTAAAAGCACTTGAGCATAGGCACCCTCGGCGAGTAACCGCACGACTTGCACGGTGACACCGCCA
ACTTGAATGGTTTCGTTCTGTAAATATCGAACAGCATGGCGGGCAATTGATTAGTGTTTGGCATTCCTCGGGGCAGAAAGTAAGCAAACTTACCTTCGAA
ACGTTCGCACTAGCATTGGAAATAGTTGCGCTAATCGACGAAAGCAAGGAGCCACCCCACTTCTTCGCCTTCTTGGCTGTCTCCGACGCTCCTTTCTTGG
CATCCTCGATAGAAATCTTCTTGGCAAAGTCGTAGGCTTGCTCCGTCTGTTTCCGCAGATAAGCCTGTGCGTCTTTGCCTGCCTCGGTCCATTCACGAGA
GCCTGATCTCCCACTGGAGTCGTATCGATCATCACGACCAAATTGAGAGCTGCGATTCTCATCGCCCGCATTGTATCCATTACCACCGTCCTGGTAGCTA
TTGTGATTCCAGTCACTCTCCGCTTGCTCCTTCCGCATTTTATCCCGCGATGGCGAACGTACAACTGAAGCTGGCGGTTCTTCATCTAGAACACCACAAC
ATACACATTAGAACCCCCAACAAGTAAACCTCCGTTCTTCTCCATTACCTTGGGACTCGTAAGTCGTGGACTCGAACTCCTCATAGTCGTCGCGATGACG
ACGTTCCGTTGTGCTACTTCCATAACTCTCGGTACGAGTCTTCGTCACTGCTGGAATCGGCGCCGGCCCTGAGGATGGTGCAGTCTCACGAGGCTCCTCA
TAGTGTAGATATTCGACACTGGGCTCGTCATCCAGCGGCGTAATCCGCGCCAGGATCTTGCGGCCACAGAACGGAACAGCCGAGTCCGGATTCGTCAAGT
CCAAGTACGCACCATCCTCGCAGCGGAAGGCGAAGTGATAATTGTTTCCCAGAGGGAACGCTTTCTGTACGTCTGCAAGCCGCACGCGGCCTCCTGTGGA
CGGTAGCGGCAGCACAAAGGCATTCCAGTTGGTGTCAGGTCCGCGCTGCGGTTTGCTCTCCTGTACAGGTTCCAGTTCTTCGCCCACTAGGGAGTATAGC
ACGAACGTGTTCTTCAGTGGCGGCGCAGCCATCGTCGTACCGCTCACCGGATGCACCACCTCGGTTGCGCGCATTCGCTTGCCGAATTAGGTTCGCAAAA
CTCCTCGATCCTACGCAACTTCATGAAAAAGTCTATAAAGAAGGTTTTGTATCGTGAAAGAGGGTTGAAGTTTGGTTTCGTATAGAGAGGTTGAAGCTAA
CGCACTACATGTCCGTGAACTCGTAGTCCGACGGACTCAGAGCCGAGTCTTCAGGTGATCGCACGGAACACTCCTTGTCTGTAGAGAAACTGGAGTCGTC
GTTGACAGAAAGAGCTTTGGTCAGGAGGTATGAGGACGTTGGCGAGGTGGATGCGGGCTTCTCGTCCAGCGCTGCGAGCACTCGTGACGTAAGCTCGGCG
TCTTCCAGCTGGGAACTTGACGAGCTTCTAGAAATACTTCGTGTAGTTTCTTCAAGTAAGTCTTCATCAGCCGACGCTGCCGTGTAGAACCTACTGCGTT
CGTTCTCGATTGGGCGCACACAAGGTCTCGCGTTCGAGAGTGCAGTCTGTAGCGGTGCAGAGGGGGGTGCTGACACACAAGCGTTTCGGTTCGATGCTGT
TGGTGGTACGAAGGCCGGGGCTTCCCAGGACACGGTGTTTCCAGAGTTATCGAAATTGCCCATTAGGATTTTATCGTAGAAAGCGGCAGCTGCAGGCTCT
CGTTGGTGAGTCTTCGTGACCAGTGTAGGGTGGAACGGATGCGACTTCTTGAACTCACGTTGCTGCTGCTTGCGAAGCTGCTCCTTGCGCTCGAGATAGT
GATCGTAGTACTGGTTGAGTGCCTCAAATACCTTGGACCCTGACAGTCGACCGTGTTTCGTGGCAATTTCACGCGAATTCTTGTCAATGACCGGATGGAA
GGTCAATTCCTTCTGCTCAGCAGCTGCAAGAGCCGCTTCTCGTTCAGGGTCTGAGTGGTGCGATTGGTGGCGATGTCGACCTCCTCTATCCGTTTGAAGA
TGTTCGGCTACGAAAATAATCTGTGAGTAGGTAACACCTGGTACTTCACGCACAAGGCGATCCATATATCCCGAGAAGGCATCGCGCGAGATCGGCGCAT
GGTTTGCATACTCAAATACGATTGCTACCACACGCGAGATCTCAACTGGTAACGCAGAGAGATCCACCCGGACTGGTATCACTGTTTCAGTGTTTGTCTC
TTGCGTTTCTTCACAGTTCGTGGGCTCTGAAGATTCACCAAACTCCGGAGTTGTTGATGGTTGACGAGACATTGTAAGAAGAGCATTAAAAATCCGCATG
CATGTATCCGCTTTTCGTCGCTCAAGCGCTTGGCGTGAGGCCTCGGAAACAAACGTTTGCTGCGATTTTTTCTCAATCTCACGCTGGTCCTTCTCCCGTA
GCTGGCGGTGGTACTCCTGTTGTTCACGGTGTGCAGCATGCAAGAAGTCTCCAATGGGCAGTCCTTGTTTATTCCGTGCAAAGGCAGGAGCTCGACCTGT
TTCTGGCTTAAACAGCTCTTTACCTGTATGTGGGTCTCGGTTTGGGGCATACTTGTCGTGAAGGGCAGCACGCTTCCGCTCCAGCTCGTGATACTTGTCC
ACTGCAAGGCGCTCGACAAAATCACTCTGGGATTTGTCAGGTGCAACCCATAGGGCATTCACGCCAATATCCGGCTTGAAAGAAAACTGCTTGAAGTATT
CTTCTTCTCGTTCTTCTCGCTGGACTCGAACCTGGAACGAATTTTCATACAACTCAAGATGAGGATTTCGGGTTCGTCGAGTCTCGCCGTTCAATGCAGC
AACAGCTGCAGCAGTCTCCTGTTTTTCACGCACAATCTCCTCCGATACGTTGTTGATTTTCGGTTTGAACGGGCAAGTTTGCTGGAATTCCTCTGCAACG
GCACTTTGGTGTCGCTGGCGCCGCATACTCGCCATCCGAAATGATTTCTCTTTGTTAGCGTTGACAGCTTTCATGGCGCTGGATGAGGTTGTGAGCAGCG
TTGGCTGGAAGAGTCGCTCAGGTTTCGGCTGCCCACAAAGAACTTCAGGCTGCACACCAAACGAACTTTTGGCGCTACTTGCAGTCCCTCGGCGTCCTGA
GTGTGATACTGTCGAGGATTTACCATGTTGAGCTCGTAGCTTTTGTGCCATTTTATTCTGACATCGAGAGTCATTGTACTGGTTCACATACGCACATTTC
GGACACATCCAGTCTTGCTGCTGCTCACGCTCCACGACTCGGCGCTCGTGTCGTTGCACCTTTCTGGCTATATCCGATAATGCTTCGTCATGGAGGCGCT
CGCCAATGTGCGCATAGTTACCGTTCGTACGGTTTGCCACGAGCTCGCGTGACTTGGCTGCCATCAGCTCGACCTGTTGCAGTCGCTGCTCATCTCGAAC
CTGTTCCAGTTCTTTCGCTTTCTGAGCGCGTTGAATCCATTTTTCTTTCGACTCAGCCAGAGCGTGAAGCCGCTCATACGCCGGTGCATCAGCAAGATTG
GTTTTCTTTTTCGAGCTACTACTACGAGTGCCTTGCACCGTAGTTGTGAAAGCTGGGGCTCTGGAAGATGCCGATACGCGCTCACCAGAACGTGAGTGCT
CCATTGTCTGCACACTGTATGGTGCAGCTGCACCACTTGGTGCAGATCGACGTCCTTCGGGGTCAACCTTGCCACTATGCTGAGAATGACCATATCTAGC
CACGAGATTGTTGTAGTTGAACTCGCGATTGTTTTCACGCTCGTGTATTTGCCATGGCGCATTAGTATGATGTTCAGGTTGGGGTCTATACGCTATATCC
ACACCATCATTTGCACGACTGGTCTCTGGGGCAGACGGAGTGAATGCAAAGGAACGAGAGTTAGCATTCACGAATTGCTCAAATTCTGCGTCGACCGCCC
ATTCGTCTTCAACAATCAGCTCAGACTGCAAATTCTTCTCGGGCTCAGCTTCAGCGAGAGCGTTAAGCTGCTCTTGAATCAAATTTCTTAATTTCGGAAC
TGAACCAGGTTGCAGTGCGTGCTTCTGCGCAAAAGCCGAAGCCAAAATATCTGGATTGTCCCCCTCGTGAATCTCGATGGTCTCAGTTCTGCCGTCACCT
ATGACAACTTCCATCAGTAGCAAAAGATCGCCGTGTTCCACTTCATTCGCGTCGACATGATCAGCTATAGGTTGCGTCTCTTCTTCATCTTGGGCGCCAA
ACAGTTCATCAGACACGTGCGCACGCCCCTCTAAGTCATTCCCGCCATTCGAAAACGGTTTTGAGGTCGCTGACTGCTTGTCAGCAGTTGCTTGAGTTGG
AGACCACATCGCTGCGGACTGTAGCTCGCTGTTAAATTGTTCACGACGGCCAAGCTCTTGCTGGACACGAGCCGCAGCTGAATCGACGGCGAATCGAATC
TCGTCCTCAATTTGTTGTGGTGAACGCGGAGGCATCTTGGTCGTTGAAACAGGTGGAGACAGGGTAGTACGCTCCAGCAGCCAATCTGGGAGGTCATCTT
CGCTTTTCCCTGTATTCTTTCCTGCTGGTGGCAGCTTGCAGTTTAGATTTGATGACAATGGGCTTCTCACTTTCATATCCAAGCTGAGTTGTGACTGTAG
CTCACGCTCAACTCCTTCACGCGGCTTATCTTGACCATCCAGCAATGAAAGCTCAGTAGCCTCACCGTCCGGTGAGTTGAACCCAGCAGGAGGACCACGA
TGCAACAACGGCGAGCTAGAGGTGACGGACTCAGCCGACGATGGCGTAGGAGAGTATTCGTCCTTGGAGCAGACCGACGAGTACGATGAGCCATCACTAT
CATCATCGCTAAAGCGGTCGGACTGACTTTTGACCTCTAGCATAAAGGACACGTCGTCACTCACAGAAGCTGGCGGAATGATCTCATCTTGTGCAATAGA
TGCTGCTTGTGCTTGCACTCCTAGGTGATCTGCTCGAAGCTCGCCCCAATAATCTGGCGGGACATTGGTACGTGTCATCGACGGAGACGAGAAGGCCTTT
CGAGGGGATTTGTCGGGGCTTTTATTGACGCTTGAATGATACTTTACCTACCACAGCACATACCATTAGCTCGATCTACTCACTCACATTAAAAGTGCTT
ACCTTTTCAATAGCTTCGACTGCTTCTCGAGAAAATGAGAAGCGTCGATGCATGCTCGTATTCCCGTACGGGTGTTCTGCTCCCCTTGTTTCTTCCATCC
CTACACTTTGTTGGGTCAATATAAGGCCTGAGTGAAGGCGGCCGGGCATGTGTGAGAAATAGCCTTGAAACGATCGGAGAGCGGCGCGGCCCATTCGCAT
ATGCGATTGTGCAGCAAACGTTTGTCGCCACGTTACGAAGACCACAGCGAAAAAAAATATCTTGTTCATCTTCAGAAACATTGCTGCTATCACTTGGACA
GACTTTCTTAATAGCGTCCCACGCATCAATTCTCACTACGTCACCACTTCCACCTGTCTTATTTTACAGGTAGCGCCAGCTGCTTCTTCCAGATCAAAGC
ACAATTTGCAAGAAAGCTCTGCATAGCGTCACGTTCTGCCCGCGCTTCCTTGCGTTGCACCGAAAAATCCAGCACAGTGCCGTCATCCAGCTCCAGATCA
CGAAACATTGGGAGCTGATCGGGAGAAAGGGCCCTCTTCTTCTTTGATGGACGAGCCTTTGCTCTTGTTGGAGCACTGGATGTTGCTGGCTGCTGTACCT
CTCGTCTCTGTCTCTTGGAGCTTCGCCCGATACCTGTGCTTTCAGCCGCCTTCGCTATTGAAACACTCTTTGAGCTAGCCTTGCCTTCATCATCCGCAGT
AGTTTTTCTTATCGCGTGAGATCTTTTAGGTTGAGGAGCAGATGAGGCCTTAACGTTGGCAGTGAGTTTCTCACTAGAAATGTTCTTCTTGTCGCTGGTC
TTCTTCTTAGCAGAACTTCGTGATGAAGTGGCTTTGGGCTCGTTATCTGGTACTGGAATAGGCGTGAACGTGGCCTCCTCAATCGTGCCCAGCATGTCTT
CGAAAAGATGCATGTCGCCATCCCAGCTCTTCACCGTCTCGTCTTTCATACGAGCTGCAGAGAAAGAAATGTCAGGCCATAGCTTTGTAGGGAGAAAAAT
ACCATAAATAACGGTACGCACGAGCGTAGCGGCCGTGAGCCGTAATGGACATGGCATCCGTCCAAAGGTCGTAGTTCTTGCTCCAACCCACAAAGTGTAC
CTTGATCTTCTGAGTGGTCAGATTGCACTGGATGATCCTGGCTTCTCCCCACAGCATCTTCTTGTCCAGAGCGTCGACGTAGTAGCCCACGCATTGAGCC
GTGTGCTTCTTTTTGGGCTTGGGCTTTGGTTTGGAGCGTCTGTCGCGTCGTCGTTTACTCTTACTCGACGTGGCCTTCTCAACAGGAGCTTCAACTGTTG
GTGTTTCCATACTTCCACCCTCTGGAGCAGGTAGTGAGCCAGATTTCGCGGGTGAAGTAGCCGCAGGGGCCCCAGTGAACGGCGTCATGGTCGGGTTTGA
TTCAACGTCGGGATTGGAGCCGCTACTCTCCGTAGAAGCGCATACAGAAGGTCAGGTTAGAAAGGATACAACATAGATAACGTGCATTGCTTACCTGGGG
GTGGCAGGAGTTGAGGAAGTCACAGGCGGGAGGCTCGCAGCCATGACAAACTTGGACCTCGTCACTCTCCGGCTGGCGGGAAAATGCCAAATCTGGGTAA
ATAATCAGTGACCTATTGAAACGACTATAGAACCTAATGGAATGCGCTAAGAGAGGTTGGATCAAGTTGAAGTTGTCATTTTGATTGGCAACAAGCCACC
GCTCAAGTTACTCTATTCAGTTCTCTCTAGTTGTGCAGTTTTCACCTCCTCAACTGCTGAAATTTGGATGGATGCCGTGTCGATGTTGAGTTCGCCATCC
ACAGGAGGAGACGGTCGAGGTAACAGAGCGAAGCGATACTGTACGCGAACGTTGTCGATGATCTGATAGTTGACGTAGTCCGGGGACGTCCACCGACGTG
TCTGGTACTTGCTGCGGACGTCGACTTGCAAAACTTCTTCAATGGCGGCCACAAACCTCCCGGGAGCGCCGCGGTAGTGTATAGAGTTTGTTGAAAGTTT
GTGGATTGTTGGTATCAAATCACTTGACTCCCATTCAATTCTGAAAAGAAAAATGTTACCCAGGTATACGAAAGAACAGACTTATGCTCTTTTGCACGTA
CTTGATGGGTGGTTGCGGAGTGGAGACCCAGTTTGCCGCGAGTGCATCCGGAAGACTATCATACGCTGCAAATGGTATCAGAAATAATTAGTTCGATATC
TTTCAACGCCATCGCAATAGTTTGCTTTCTTACCTGCAATGTACGGTTTGATATCAAGCACTGGGGTCTCGTCGAGCAAATCAACTCCCGATAGATACAC
CGTGCGTTTGCGCATGTCGACACGCTCAATCTTTGCCAACGTGATTCCGATTGGGTTGGGTCGGTGAGGTGACCGCGTGCAAAAGATGCCTACTCGTTCC
TTCAGCATTGGAGGGGAGATTTTGGCCTATTGAGCATATACAGTTGCGTATTAGCGACAATCAATTGTTAGCTCAGTCCAACTAACGTTAATGCATACTC
GGAACGTGTGCCGATGGCTATCCGATCGGAGACCCTCGTGCGCTCGAGTGTTCTTGCCATTCGTGTTTTGGTGGAAAACGAAGACGATCCAGACGTGGCT
GAAATCCTCTAATCCGACTAAGGTATCTGGGGAGATACTCCGCTGAAATGTAATCTTTGCCCTCGTCGATGGTGCAAGTGAACCTTGACGAGGTGTGCCT
ACAACCTCACAGCGTGCAGCCTCATCAAAACGAAATAGTATCATCAAGCGATACAATATATAAATATCTACGCACCCAAGCACACCTTGAAGCAAGAGCG
AACTGTTCCCACAGGCTGTACGAAACAACCCTTGCTAGTGTCCAGTTTCTCTTCCATCACACGTCGCAGCTCCTTATTAACAGGGGCACAAGTGCATCAG
GCTCCAGCCATTGCAACCAAATGATTCTCAATAGTTTGCTACCTTCTCTGCAGCTACGCGACCTCGTCTTTCATCAACGCGTGCTTTCTCTTTCCTAGTC
GCATCACACTCCAGCTTCTACAATGACCGAGCAATGGCAATACGTTGAAAACTGACAACATCTCATTGATCCAATCAACGAGTAGTACCTTAATCTTCTG
GAAATCACCAGACTCAAGTTGCGACTGTTTCCACCAGAGCCATAGCAATGCCGTGGTCTGCAGCGTCAATGCCAGTGTCTCTAGCCTCAGACCAAAGGGC
AACGTCATTGTTGCTGAACTGCCAGTAGTCGAATTGATGGCGAGCATCCTGCAATCCTCATTCATTGGTTATTATTCATCTTTAAAATGATTGGTCCGAT
TGAATTTACTCTGCTGCGATTGGACAAACGCACAGCTGATCTTTTGGAGTGCTGTCAGTATTGAAGCTGGAGCCAAACGATGAGGAAGAACTCGGGTGAC
CGCACCATGTCTGCAGCTTTGCAGCACCGCAAGGTGCGTGTGTCTGCCTTTTGTATTATTTAATCCCACTAAAGTCACTTTGTGGTTGTGTGCTGTAGGT
ATCAGGCTCTTTCGAGAAGTCGCAGGCGGAAAAACTCCACTCAAACGTGGTTAACCGACACTCTCCAGTGATGGCTCGTCGTTCGCGCGGGTACCATTCG
GTCGCAACCGTCAACACTACGAATGGGAATAAAGGCATGGGGCTTCTTCCGTCTTTGGGCATCGGCGTCGCTGTCGCTGGGTCTATGTTCGTTGTGAGCT
ACGCAGCCGTGCTTTCGGCGATGACCGAGACGGCTTGAAGGTGTCAAGCGCTAGCTAACGGAAAGAGAAGCAATGAAAAGAGAAATAATGGCTGTCCTTG
ATTAAATTTACATATAATACCAACACGAAATGTTGGTGTTGTGTTGAATTGTTTGCGCGCTTCTTCCGGCTTCAATCATTTTTCTTGCATGTGTTGGGCT
TGGTCACCACCTTCTTGAAGGCAAAATGTTCACGAACGAGGTCCAGCGAGCTCAACTGCATGTAAGTGCAGCACACTCCGGTACCAGCTGCCACCATGAG
CAACCACTCGAGGGATTTCCGCTCCAAGTTGTGGAGAGTGTGCAAGAACAGCATGGAGCACAGTGCAGCGGGGACAAGCCGCGATATCCATGACGAGCAA
CGTGTGAAGAAGAAGATGGTGATGCCGCCGAGAATATAGCCAACGATAGTTGGGTACACGCCACCAGCTTCGTACGACATGTTCAGAAGGTCACGCCATG
AGACCTGTGCAGCGGTAGCGATCAGTACATGTGAGTGTGTCAACCAGGTAAATGCAGTAATTCACCTCCTCCATCATGCGCTTGCCTCCTAGCTGCGCTG
CTCGTATAAGTTCCTCCATCATCAATGCCATTGCCAGTACTTGATACAGAAGTAAAGTGAGGCGGTGTCATGCGCACTCCGAAGTCGTTTCGCTTTCTGT
TTTTGAAAAACATGTATAAAAGCTAAAACTGTTTTAAGTGTGACCCCTGTCAACGCATAACCTCCGCCTTGCCTTGCAAAAATGAGTAGCGTTTATCTTT
TAACACTAGCGGTCAGCTCACTATGAAGCAATGACACTGATTCAATCTACAATCAGTCTGATTACAGCCATATTACAGCAATTGGATGCCTACAAAGGAG
AAAAACCATAGTCAACGGGGAGGAAACGCTAGTTGTTGACTGGGAGGTTGTGCTGTTGGAGGAATCAGCTGCTTGTGAGGCATACGCGTTCTCAGTGAAC
AAGTATTCCGTCGGAGGTGTCGGGGCCGCCGTCACGTCTGCTTCAACGTAGCTCGACGCAGAAGCCGTTCTTAAGGAACTTCTTTCGCTACCAACGCTTG
ACACCTCGTCGGGGAAAGAGCCCCCATACATGCCGCTAGACGAGCTGCCATATTCAGGTCTCGGTCTTCGTTCATCGTTCATCGTTCATCGTTCATCGTT
GGAGGATTGTTACTTGTTATCGCTTCTTGACTCGATGTCATTACCAAATTCGCCGAGTTTTCGCTTCCACTTCAGCTTGAACACAATCTTGCCATCGAAC
TTGCACACACTCGTTTGCTCCATCCGCACAGTCGGCGCTTCTCGTTGTGCAAATCTCTGTGTAGTTTTTGCTGTCGAAGTAGCAGTCCGGAGCGTTTGCT
ACCATCTAGTCGAGCCAACTTGGCTCAGCTAAGTCACACATTCCGGCAGTGGATCGCCATACGCATGCTCAATAGCACGGTTCGGCTGGTTTCGCGTTCT
GATCGTGCAACTTGATGGCGAGCTCCTTCTCGTACTGCGTGCAGAATTTCGTGTGTTCAGCAGTACCAACACTACTGGCAGCAGGCAGGACCTTTAAAAA
GGTCTTCGTCATGTCATTCGGAAAGTCTCAGTGCACCTTAGAGCTTTTGGATCGTGGCTCAACTGCTCGTAGTAGCCCTCAAACTCAAATAATCTTTAGA
AAACTCACCGGAATCGGAATCCACCATGACTTTCACCCCGCCATCTCGCATCGAATCATTAGCTTCGAACGATAAAACAAAGCCAACATGTAGGCAACAT
TTCTCTCCGTAGCCTGCACCACAAATTCAAGAATCACTTCACCACGAATTCTACGGTAGGACTCAGCATTCCCACCCCACGCTTTTGTATCAATCAAATG
AGCTGCAGTTTGATAAGCTTGCATGTACTTAAGTATAAGGTAATAAATATTCTTTCACCACCAAGACCCAGCTCTTGACGATCGTGTTCATTACTGTCAC
TGCCACATGAATGTTCCACCGATATGTAGGTTTTCACTTGGCGAATCAATGGTCTCGATTATCCACCAAACCATTTTTGTTTTTGCAAACGCGCTTTCCA
CTCGAGTTAACTCACAATCACAACCGAATTTCAAAACACAATGGACAAGCAGAGTGCCATCGCGCTGGGCGTGACTGCCGGTCTGGGCGTCGGCTACCTG
TTGGGTAAGGCTCAGCCTTCTGTGCCTCGCGTTAAGGCGGGGCAGAAGCCCACAACGGATCTCGATGAGGTGGAGAGGCTCATCCGTCCCAACATCCTGT
CGCTCACGCCCTACCGATGTGCGCGGGATGACTACGACCAAGGTAACATGGCAGTACTACGCTACCGACAGCTATGGCCACACACTAAATCGTCTTTCTG
GCAGGTATTTTACTGGATGCCAACGAGAACAGCCTAGGCCCTCCACTGCAGGGCCACTCGCAGCTTCAAGCCATGGAACTGGAGCGCTACCCGTGTCCGT
ATCAGCCTGAGCTGAAGAATGTCATCACCGACTTCAGGTACGTCAGCTCATGCGTCAGAGTGTCGATCTCGACGCCGTGCTAACTCTCCAATTTAAAATA
TACTTGCAGAAACCAGAACTCAACTGAGAAGATCAGCCAAGCGAACGCGTTCTTGGGCGTTGGAAGCGACGAGGCCATTGACCTGATCATCCGCGTGGCT
TGCACGCCTCGCGTCGACAATATCATGATCACTCCGCCCACCTACGGCATGTACAGTGTGTGCGCTAACATTCACGACGTGGGAATTGTCTCCGTGCCAC
TGCAAATTGAAGCTCTGGCAGAAAACTTGAAGGGACTGAAGCCAGATCTCCCGCTGCCGGCCTTCCACATTGACCCCCAGGAGGTGCGCCTTTGATAACT
TCGTTGACCCCGACATGATGATGTGCATCTAATCTCTCTCTTCTGTTTCAGATTCTTAACGCCGCTACTGACTCCACCAAGGTGATCTTCCTGTGCAGTC
CTGGTAACCCCACGGCCAACGTGCTGCGCCTAGAAGATGTGGAGACGATTCTGAACTCAAAGGTTGGTAGCTGCTCTGCTAGATTGTTGTTGTTCGCTGT
TTCTAACGCAAGCCTGACTGTTCTTCAGAAGTACAAGGGTTTTGTGGTGGTAGATGAAGCCTACATTGACTTCTCGGACACCGCCAGTCTGTGTACACTC
GTGAACAAGCACAGAAGATTGATTGTTCTTCAAACGCTCTCGAAGGGCTTTGGGCTTGCTGGTATTCGCCTGGGTGTTGCTTTCGGTGACCCGAAGCTTA
TTCAAGTGCTCAACAACGTGAAGGCGCCGTACAACATCAGCAAATTGACGTCTGATGTCGCACGCAAAGCATTCTCGAACCTGGATGAGCTGCGCAAGAA
CGTGAACCTAATCAAGGAGGCAAGTGTGAACTATTTCATTGATGATTAGGAACATTACTAATTTGTTTGCCGCTTGTATTGCAGGAGAAATATCGGGTGA
TCAAGGAGCTGCAAAAGCTGTCTTTCGTGCGTTGTATCTACGCCTCTGACTCCAATTTCGTGCTGTTTGAGGTAGGTACACTTGCTCTGATAATTTTGAT
ATTTTTTTCAATCTTACGTTTTTTGTTATCAGATCCCGCATGCGCTGTCAGTGTATCGGCAAATGGCTGGCCGAGGCGTTGTAATTCGCTATCGAGGCAA
CCAGCACTTGCTCACTGACTGTCTTCGTGCCACGATTGGATCCCGTGAGGAGAATGACCGTATGCTCGAATTGCTTGTGGAAGTATACGGTGAGCAATAA
GTCGAGCCAGGAAGGTGATTCAGTTCGCTGCTCTCAGCGATATAGTGCTAGTTCGAGGGCGATATCTGACATATAGGAGTGTGCGCTGCATTGCGTACAA
CTCACCTACTTTTACCATGCTGATAAATTCAAAACATGAAGCGCTATATTGGAGGTGCTGCAGCTGGATGTTGCTGGGCTGGGTCCTCTGATAACTACAT
TTACCAAAGACTGGTCGACAACCATTCGGGGGCGATTGGAAGGTATGGTTGGAGCTTCAAAGAGAGATCAGTTCTTCCTGGATATGGACTATTAGTCGGA
CTCATCAGGACTAGGACATGATGGAATTAAATCGCTGCGAAACACAAAGAATATGACCCATGTAAAATGCTTCTGTGCGAGTAACGTGAGGAGGGGGCAT
GAAATATCATGATGTGATCCGGTGAAAGGCACCACCTCCTTATTTCTCTTACTTTCTCCCAGCGACGTAAAAGCTACAATGGACAGCTGCATTGCGTAGA
ATTTTTAAGTAAGCCGTACGTAACTCTCTGCTGGCAAAATCAAGACTGAACGAAGCTTTCGTCTTCTCCCTTGAATGTGGTCACAACATTTCTCACGACA
CAGTTAAAATGGTTGGGATGTTATTAATCTCCATACAAAAAATCAACACCTTTAAATCGTTTACCAAAAGTGCCGTACTTATCCTCGAAGCAAACTTTTT
CTCAACGGATCTCCTCCATCGGATGCGTTATCAGCGCCCATGCCCTTGCCAAAGAACAGTCTGCCACCTCGAATGGGACTCGAAGTTGCGGAGAGACCAC
CAGGTCTTCTACGAGGAGGAAGTCGTCGGTTAAAGTACAATACCGACAGCGCCGGCACAACTTCCAACAGCGCGTAGTACACCACGACTACAAACCACGT
ACTGCGGTCATGCAGCTGCTTCTTTTCCGTGGACAAATAGATTTGCAGTCCGCAACGAGTCATGAAGCAGGACGTGCCGACCGATGTCATGATCGCAAGC
TCCTTGAGCTTTCTTGATCGAATGCCAAGCTCCACCGGTACAGATCTAAACTCGACAAAATATTGCGAATCAGTCAGTTGAACAAAATTTTCTCGTTCTG
CTATCAGGTACTCACCGCAGTTCAATGTAAGCGTTCCGTCCAAAGTAGATAAAGCCGGTGGCGATAATCAAGAAGAGCTCCATGTTCAAGATTGCTTGTG
ATCGGGTAAAGAAGGCACCTGCAATAAACCACAGCTTAGACTTTAATGGTTGACAATTCCACTATTGCAACTGGCTAAGCACGTACGTTCGTGACGCCAC
ACAGACGCGTAGAACACCCAAAACAATCCTTGAATGAGCAGCACAATCTACACACACGCCTCATCAGTGCCACTATGTTCTACCAATGCAATATCTTCGC
AAAGCTATCGTCGTACCACGATGAACCATCGGATCGCAGGCTTCACCACGTCCGTCAGTGTCGATAGCTTATCCACAGCGTTGTAGTACACCTCCGCCCA
AAATTGAACCAACAGCGCATAGATCGCAAAGAATGCCATAATTGGCACTTGGTCCAAGATGTAGAACAGGTCTCGCTCGCCTGTAGAGCACTTGGATACA
TTGACCTTCCCACTCAGCACGTCGCACCAGTCAGAGCCCACTAACGCTAGGAAAATCGAGCGGACTGCAGCATGAAAATTAAAGAACACACCCACGCTCA
TTAGAGTGCAACATTATCATATCAGGATTTATGCTCAAGAATGCTCACCGAGTGTCGCGAAGAACATGAGCAGATGAATCATCTTTTGAACGGTCCACGG
GCGATAGCGGCAACAGTTGCGCACAAGCTGGACACCCGCTGCGCCTCCCACAAGTGCGTAAACGATGCCATCAACAAGGAACGCGGCACCAACGCCCAGT
TCCTCGTCCCCCGAACCGCTGCCGTTGTCGCTTCCCCGCGCTAGGAGCAACACCCACGTCGGTTCCATTGCTATTGAAGAATGATGTCACTAACTCCTGA
TTTTGTCCTCTATTTAGTGACAGTTTTGTCAGATTTGGAAAAATAAAATGGCGGCAAGCACAGCACCGAGTGCGGAATTACGCGCTGAGGACGTGCGGCA
GTTATGGAGCCTGGCGCGCTTATTGGCACAAAAGAAGCTGACGATGCAGACAGCTCAGTGTCTCAAGGTGAGCGACTGACGGCGTACACTCAATAACTGG
TCCGTAAAGAGAGATTCTAATTACCTTTTTTGCCCTATAGCCCCTTTGCGCACTCGATTGCAGCATCCGCAGCGCCGAAGAGCAAGCGATTTTGCTGCAA
GCGAACATTCTTCTAGCTGAGATCTGCAGTGTAGCCTGTAGCAACAAAAAGAAGGCGGACCCAGATCTGTGGACACGCCGAGTGATCCAGACAGAGGAAT
GCATCCATTCAGCTGATGCTGCCATTGCACGGGGAATTTCTTGTAGTGTAAGTTGTAGTTGATGAACAGTTGTATTGGGTGTGTAGTGATTGTTGTGTTG
TGTTGTGGTCTGTAGCATGAGAATAGGCTGCGGCTACTGAAGGCGAAGTTTTTGCTGCAGCAACAGTTGAAGATCGATCGGGCGGCGAAAAATCGTCGGA
TGCTGGAGATTCTGTGCGAAGGACTGATAAGCTGTGCAGAAGCTGAAGACGATGACCCTGAGCTGGCCGCCGAGTTTCGGAAATATTTTGGTGTGAAATT
GAAGGCCTGTTTGGTGAAAATGCACGCTGCAACCGTCAAGGCAAAGTATTCCAAAGACAACGATGCCGTCACTAGTTTGGCGGATAACTTGAAGTATCTG
CGAACTACGCTGCCGAGCTCTGTCGACAAACACTTTCTGGTAGGACATTGAGCTAGGTGCATTGATTTTTTTGCTATTCGAGTTGATCTGTTGCGATACT
GACGTTTTATGCTTGTTCCTTACAGTTGTGGCTGGTGGAAGTGACCTGCCACACCGCGATCTCGTCTTTTCAGCCTGAAAACGCCGCAGACATGCACCAA
CTGGTTGCATTTGGCCAGGAATTCTTTGACAAAGTGGCGCTCGAGCACCCGGTCTCACGAGATTTCCGCATTCACCATTTAATTATCACTGGATTCTACT
ACTTACGGTAGGTTTCGATTACTGGAGCTAACACGCGACGGTATCCTAATTACTTGATGTTGCTTAATAGGACCGGAAAGCTAGCGAAAGTGACACCGCT
CCTGGAGCAAATCCAAGCCTTTGTTCGTGGCACTGGTAGTGGTGACCAACAGCTTTCCGGCGTTTTGAAGGACAGATACCTGAACACAATCCTGGACTCG
ATGCGTGTGGCCGTCCTTGCATGCTCGGATTCAAAGCAGGCGCTTGATCTTGCCTTGACTACCGCAGTCGCAGCTCAAGCCAACCTGAACACATACGACA
AGTACCCGGCAGTGCAACTCATGCTCATAGCAACGCTGTTCGATATGGTATATGTCTACTGCCGGCTGCTGGGCTTGCAGTGTCGATACGCGGACTTGGG
AGCTAGCATCGCTCAGATGACTACTTTATTCGCCAAGTATAAGTCGCATTTGGAGCGTAGCATCTTCTATCGCTTCTTCCTCGCGCGGTGCCACACACTG
ATTGCAAAGGTATTGCATTTTGCAAACTACAATTCACTGAGCTCGCTAACGCTTTTGATGATAATCCCAAATGTGCAGTATGCAACAGCCATTGGGAAGG
TGAAAGAAGCGTGTTCCCATTTGAATTTCGTCGTCGACAAGGTGCTTCCTGCTCCCACGAACGAGGAAATGCCATATCCCGATGCATACCTGGCCGTGTG
GGTCGACGTGCTCGAAGTGGCGATGTATTGCTGCGGAGAAACAACACAATCATCTCCGTTAAATGACAGTGCTACGGCATTACACGTCAGACAGATCTAT
CCAAGCCGGGTGCTGCTAAAATGGGTCACTCGTATTCTGAAATCCGACGGCTTGAGGCATCAGGTGAACCAGTGCTGTAGTGTCGAGTTGAAAGCAAAGG
TATGAACGCATTGTTGAGTAGTCATTGCTTCTACAAATACTAACCATGGCGTTCTCAATTTGTAGTACAACCTTGCGCTAGCCAAGTGGATGTGGGCTAC
AGAAAGACTGTCAAGTGACAGCGATGCCGCCCACTTCACCCAGCATACAGAACTGGAGGAACTGCGTCCGAAAGCGTTCACGCTCCTTCACGAGGCTCTC
CAGCACATGAACACAAGTGTTATGTGCTGCGAGACCACATCAGAGACCATGGCGCTCTTTGGACCACATCTGGTGGCTTACGGCAAGATGAAGGAGGGCG
AGGAAATACTGAAAAACGCCATCGACACAAGTCTCCAGACCAAGAATGTTTTGCTGCAGACGCGACTTTGTGCGGATGTGTTCCAGTTCTATTCGAACAA
GGGGCTGATTGAGGAGAAGGCAACTATAGCCTCCAAGTACGAGAAGAAGTTGGCTCTGCTCCAGCGACGAATCGCGGCCGCACAGGCCGAAAATGCCACG
ACCACAGCACTGTTGCGATGGACTGCTGGTTCGAAGGCGTCGAAACCCTCGCGTGGATGAACCAACTGATCTGTCACAGCAATCGGACACAAGACCGACG
TGTGCACCGGATCGTGCCTGCATTGAATCTGCCTGCGTTGCTCATTTATATTATCCACAAGACGAAATCTTGCGTTCCGCCTTGCGCACCCGTTCGGTGC
TTTTTCTCCAGTCGTCGTCACGCCTACACGTCATCGATCTGATCATAGTCGTGCCACAGCGCCCGCTGTGTGCTTGACCGCCTGCGCCATCGGGACGCCC
TGAGCCTTCATCGCTGTCGCGCACGTTGATCCTGCTGCCTCCGCCTGAATCAATACGAAAGCCGCGTTAGCAGTCTTCTAGCGATATTCACCGAATTAGC
TCGACGCTCTCACCATGAAGCGCAGTTCATTCTGGAAGGACACAGTGAAGTTGCCCACCAACATGTCCGCTACGCGTTGGAGCGCCCGCAACACTTCCTC
CTTCATCGCGACTTTCTGGGTTAAAAGTGTCTACTTGACACAGATTGCAGCCTGCACAAAATGGGTACATCGTACCGTTTTGCCAGCTGTCTCTGCCATT
ACTCGGCTCATCTGGCATCCAACTGCCCAGACCAGACGCCAGGTCGCACCTTGAAGAAACTGCGTTCTAAAGCCACCACAAAGCTTTTCTCCACGTCGAG
CGCCCCCAAGCTCTCGTAGCTAAGCATTGGCCACCTCGTTGTCTATCGCCATGCGCCACCAGTACGTTGAGAAGGTTGATCTCGACAGCCTCCCCATTTC
TGTCTTTTGTAACCTTATAATGGGCCCTTCATCTCATTTCTGACGTGTCTGGTTGATGGATAGGAAGCGACTATGCGTGGAGGTGGTCGGCGCTCGCAAT
CTCGAGAGTCCTCAGTCCGTGGACGCCTACTGCGTGGTGGGGCTGTGTGACATCAAGCCCAGGAAGGCGCTCGGGCGCCCGCGCCTTGCCGCATCGCCTA
GTTTCCGCTCGTCGACTGTGACAGCTTCTAACAACCCCACTTGGGGTCATGTGGTCGAGTTCGTGGTGCCTGCTCGTCCTGCGAGCGCGCGACTGAGAGT
GCAGCTCTTCAGTGAGAAAAATTTCTTCTTTGACATGTTCCCATCGAGTAGCAATTCGTCCGATGAGGAAGGAGAGAAACTGAGGGATCAAACGGACTAC
ACAGCAAAGGAACAGTGGAGGAGCGCAGTGTCCAAGCCACAGATCTTTGTCAATGGAGGCAAAGGGATATATGACAGCGACAGTGATGATGTCGTGACGC
TTTCGGAGGAGGAAGATGAGGATGACGACCAGGTTATTGATGAGGACGATGTCTGGCCGGTAATTGAAAAGGAGGCACTTGCTGCAACAGAAAGTATTGA
CGACGAGCTATTGGGTGTTGTGGAGATCAACTCGAGCTTGTTGTGTAAGCCATCGAGAGTTGTAACCGACTCATGGTACTGTCTCGGCGGCACGAGGACA
GGTGAGGTGCGGATTCGCACCATTTGGTATGAAGGAGCGAAACGAGTTCTAACGGTACAGGATCGA