Description :
From Genome Similarity Track
Location :
Scaffold_383:8635- 12317
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_383-fgenesh-gene-0.8Flagellar associated protein
Pytve_DAOMBR484maker-pve_contig_383-fgenesh-gene-0.0HECT E3 ubiquitin ligase

Sequence
3682 bases(100 bases per row)
CCTCTTATCCTCCCATTTGTGGCGGGCGAGGTCGCTAGATAGATACACATTCACGGGTGGCACGGAGACAGCGCTACTCGCTGCCACAAACTAACTTCGC
TCTCGCGCCTTAGAAGGACGAGGGCGACTTGTTGTCGGCGCCGACGCGGCGCGCCGTGTTCTCCCACAGGCGGCGGCGCACGAAGCAGAGCGGCGGCTTN
NNNNNNNNNGCCGACCACGGACCCGCGAACGTGCGCGCGTACTGCCAGCCCTGCGCGTCGCCCTGCTTGGACGTGAAGGCCCAGCCCGACGCCTCCAGAT
GGCTCGGGATGCGCGGCGCGACCTCGTTGAACGCGGGCGACGTGCTCGTCTCGTCGTAGCTCGCGAACTGCTTGCGCTCGGCCGTNNNNNNNNNNCTCGT
CGGGTTCCACCCGCGACCGGGAGACCAGCTCTCGTACTCCCACACGTAGAACTTCTTCTCCTCGTCGTCGAACTGCGAGAGGCAGATCTCGAGCTGCAGC
GTCGAGTTGACCTTCTGGCTGTCGAACTCGCTCGGCACCGACAGCGGGTAGTTCTCGACCACGGGCACCTCCAGGTCGAACTTGGCCACGGGGAGCACCA
GCTCGCCGATCAGGTCGTCCGGGTTGAACGCGTCCAGGTCCCACACCTTGGCCGTCAGCACGGCACGCTGCGGGTCGGCCACCTCGAACGTGCACACCTC
CGCTGGGTCCCACACCGGGTTCAGGTTGTCCTTGATGCACCGCGTGCGGTGGGTCTTGCCGCCCAGCTCGAGGATCACGTACGGGTCGCTCTTGCCGCCC
ACGAGGCTGTAATCGCTGGCCGCCAGGTCGCTCGCGCTCGTGATCTTGACCGACAGGAACGGCATGGTTCTCTTGGGCAGGGTATGAAGCAGGAGGTTGG
ATGAGAGAGCTCGGGCTTGGATGAGGGCGGACGAATTGCGGAATGAGCGGCGCGATCTACTGCTGAAAACGAAGAGCGGCGGGTGGTGCCGGAGGAGTGA
TGATCCCTCGATTTAGCGGTGGTGGCGAGAGCTGACATGTACCCGCCATGCACGCGCGGCGGTGGAAGAGCGAGCGGCGGACTGTAAAGCCGCGGAGGCG
ATCGCTGAGACAGTGGGCTGCGACATTGCGGCGGAGAAGCTAAATCCAGGGAGGCGGACAGGTTGAGTTGCGGTGTACCGATTGCGGAGGTCGCTTCAGC
ATACAAACTGCGAGTGGCTTGGGTGGATTTTGTACGGTGCATTTGCGACATATCATATTCTGACGGGTGGATTTTTACCTTATTTGTTGGCTCCCGTACC
GTCAACTTGATTTGGGGCAAAACAATGCGGCGAGCTCACAAAATGAAAATGTGCACTTTTTGGTTGGTAACCTCGGCAACTGCAACTCTCGGCGTGTCAT
CATGGGCTTTGCAGCTGCCCAATCACGACAGCCGTGCGTCAACAAAACCTTTCAGACCCGATCTCCAGAGCCACTGCCAACCCCAATCGACTCACCATCA
CGTGCGAAAGACCTGCGAGACAGCATACGTCGCCTGTCGCCACTGCGTTTCACGTCACGGTCACGCGTGCACACATCTCGATCGGCCGGCTCTCTAGCTC
TCGCCTGCCTGCCCGCGCGTCGGCCAGCCGGAGCCGCGCCATGTCGTCTTCAAACACGGACGTCGACTCGATGGTCACGGCCGTCCAGTGGGTCGGTGCC
GTGCTCGGCATCTTCTTCATCGCGGTCGTCGGCGGCGTCATCTACCTGTGCTGCCGCAAGTCGGCACCGGAGGGCGACAACCGCGCGCTGCTCGACGGAC
TGCTGCGGCGCGACCAGCTCGAGGAGTCCGAACTCGAGAGCGACGAGAGGGGATGGCAGTGCGTCGTCTGCGCCTATACCAACAAAGTCGAGCGCAAGAC
GTGTCTCATGTGCGGCACCGCCGTCGGTACGTCGTCGAACACCATCCAGCGTTTGCTCCGTCAATGGCTGACTAGAATCGATATATGTTCGGCAGATTTC
CTGGTGTCGAAGACGCTGAACCGGCACAAGAGCTCCAAGACGATCCTGCAGAACGCAGTGGACGATGCTGCTGTTGCTGGGGTTGGCGATGCGCCAACTG
GAACCAGCGAGGAGGAGGACCTGCGCGCACGGCAGCGCGCGTTTGTCAAGCGGCGACTGAACGCGCTCGAGGCGCGGCAGAGCCTGTCGCAGCGCCAGCG
TGGGGCGATTCGCCGCCGCGTGTGGGAGCGCAAGCAGCTGGACGACGGCAAGTTCCACTGGATCCGGCAGAACAGCAAGGACGTCGTCAGCGCGCAGCTG
CCGAGCGTCTCGAGTACGATGCTGTCCACGTCCGACTCGCTGCCGGACACGCATGCGCCGAAGGGCGTGGCGCTGTCTGGACCTGATGGCCAGAGCGTCG
TGGACTACCACAACCTGCGCTCGCAGGGCTTCGTGTCGCACTACGATGAGCTCGGTCGCCTCGCGTGGAAGCGGGCCGACGAAGGTACCAACCAGACAAG
GCTTGGCATTGTGGAGGTGACAGAGGTGCTCATGTTGATGTTGATGTTGATGTTCTTGTGTGTATGGGACAGTATTGATCGACCTGAACTCGTCCGAGTT
CAAGGACGCACTGGTGGCGGACGAGAAGATCGACTTCGAGGTATGGCTTTGGAGCCGTCAAATCTGGTTCAAACTCGCGGCACCGACGGAGACATTGTGT
ATTGGCAGGGTGTGATGGCGTTAGGCTTCCAGCGCAAGAAGCAGTGGTTCCTCATCCACTTGTCGCGGATCGCCACTCCCGTCACAGAGGCAGTCGCGAA
ACTGAGTACGTGCATCGGTGTCACTCGACGCCAATCAGTCCGGTGCAGGCTAACATTTTGCCCAATGTTCTTCTGCCAGCCGTCTCCCGGGATCACATTA
TGGACGAGACCATGCAACTCGCGACAGCGCCTCCGGATGCGATGCGCACCTACTTGAAGATCTCGTTCGACGGCGAGCCGGGCATTGACGCCGGCGGACT
CCTGCGCGAGTGGTTCGGGATTGTGTGCAAGGACTTGTTCAGCGAGCAGCGGGGACTGTTTATCCCGACCAAGGGAGAGGACATGAGCTATTGGATCAAC
CCACTAGCCGGAGACACGAACAAGGAGCACTTGCAGTACTTCCGGCTCGCTGGCATCTTGGTGGGCAAGGCTCTGTTCGAGGGACTTGTGATGGATGTCC
ACTTGGCGCTGCCGCTGCTCAAGCACGTGCTCGGCATCCCCATCTCCTTCTCCGACTTGGAGTTTCTCGACGCCGACTTGCACCGCAACTGCCAGTGGCT
GAAGACGAACGACCACGCTGAGAGTCTGTGCCTGACGTTCAGCGTCATGCTGGAGAACGGCACGGAGATCGACCTGAAGGAGAACGGCCGCAACATCGAC
GTGACGGACGACAACAAGGAGGAGTACCTCCAGCTCGTGCTCGAGCACCGCATGCTCGACAGCATCGCTGAGCAGCTGCAGGAGTTTCTCACGGGAATCT
ACGACGTGGTGCCCAAGTCGCTGCTGTCCGTGTTCGACTACCAGGAGCTCGAGCTCATGCTGTGCGGCATTCCGACCATCGACACGGCTGATTGGAAAGC
GAATGCGCACGTGCGGTACATCAAAGAGGACGAGAACAAGCGGCCGAAGCTGACCGAGGATCAGCAGAACTCGGTGGTCGAG