Description :
From Genome Similarity Track
Location :
Scaffold_327:8633- 11058
Transcript NameFunction/comments
g16151.t1hypothetical protein

Sequence
2425 bases(100 bases per row)
TTACCTGAAGAGTGCCCGTCACTCTTCCGGGTTGGGTATATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACAT
ATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAA
CCGTTCCCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACA
CTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAG
TTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCG
AGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCCAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGAAAACCAGT
TCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTATGGACGCG
GCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGCGAAGCGACAACGCCTG
GATGCTTTGCATCCTGGGCCCAGCTGTGTGAACAGCTTCGAGCCCCCTTCTTCCCGGCGAACTATGAGTATCGCCAGCGCTCACGCTTCCTTGCGTGCAA
GCAAGGGAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGTG
TTCATGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGGAGT
ACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGAT
GGACCTGAGCCTTGCCGAACAGCACGACATCCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCGG
TTTCCTCCCAAGCCCTTTGGTCCTTGGGGTCGCTGGCAAAAGCCGCGACCCCGTGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGG
GAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAACCCCTGAGAGTCCCTGTACTCTCGAAGCGGAGAAGGGCAGCGGAG
GGCTGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTAATCGATTCTGGGGCGTCAAAGTACTTTGCACGCCGCCGGACGGT
CGCTCGCAAGAGCGACCAGTTCTCCGATGCTTTACGAGAAAGTAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCC
AAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGC
CATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGTCTGCTGCTACTGACAGAGTATTGGTGAGTCATGTTCC
CACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTACGGCAGGAACCGCAACAGGTGTCATGACACCGTCC
ACTGCGGGCAACGGAGCGCCGCAGACAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTATG
GCACCGTACGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGCGGTCGAGACCGTGGCCAGGGT
CGAGGTTGCTGGGAGCACCTCTAGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCATCCCTGAGTCACCACCGGCTGTGGGTAAC
AATGGACCATGCCGTGGTGGGCATCGACGACGTCATCGCCGCCGTAAGCCGAGTCTGTTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGA
ACTCTCCTCAGGCACGGCCGGCCGA