Description :
From Genome Similarity Track
Location :
Scaffold_590:8632- 12056
Transcript NameFunction/comments
Phyta_totarag9485hypothetical protein PHYSODRAFT_510216
Phyta_totarag9486hypothetical protein PHYSODRAFT_252911
Phyta_totarag9487hypothetical protein PHYSODRAFT_560537

Sequence
3424 bases(100 bases per row)
gcgagcagtagcagcggtCTCCACTCGACGGCCGCCATCGTCGGTCTCATTGCTGCCGTCTGTGCGGCATTAGGAGCCGTCGTTGGCGTGGCAGTGGTCG
TTcacaagaagcgcaaactGCTTCAAGAGAGCAAGAACATGGACGACCGCGTCTCGGGCGACTCGCTGGCGTCGTACGCCAGCATCCGTACCCCGAGGTC
GGACGTTCCTGTAATGTACTCTGAAGTGTAAAGGGGTATCCAGGAAACAAGCGAGCATGGAGTCTATGACCAAGCTTGCAACGttgtatgtacatgtatc
gtaTCCTGGTATCGTAGTAAGGAAATCTTAGAGCACCGAGAATGAGTGCCAAATGTGACCAAAGTGTTACCGGTATGCACGATGCAAGTTCAAGTTGCCT
ACGTGTTCCTTGATACCCCGATGAACGCCAATGTGAAGGCAATGCAGTTTGTTTTAACATGTAAATGAGCTGGCGTGCTTGCAATTGGCGTTGAAGCTCA
GCTCAGCTAATCAAGAGTTAGCGACCAGGTCGCACGCCATTGCCATTGCCACTGCCtgcgccttcgccttcgcgACGCAACGGTTGCGGTGCCGCCGCGA
AAGGATCACGTCGCCGCGGACGTTGTCGGCGTCAATGCAATGCTTGACAAGCTCAAATGGTTGTTGACTCAGCTCGGTGAGCTCCATGTTCTTATCCACT
TTACATCGATAAGAAGTCACGGCGCAATTGACAGCCACAGCGTCTCTACTATCGGTCGCCACGTGGCTGCGTCAATCTAGAGAATCGTTGAAAAACAGGA
AGAACGCAGCCATGCACGCCGGCTGCTTAGGCATCTGGCTGCAGGTTGTCATCTGCCGCTGTCGTTCATGCCTTCGAGCACTGCATTTTCGTTGGCGTAC
GCCTAAACAGCTCTTGAAGAAGACAGGGTTGAGGACATTCGTCAGCCATGCAGCTGCTCTGCAGCATGGAGAACTTGGCAGCATTGCAGGGCCAACGCCA
CCGACGAACTCTGCAGTCTTCATTCTTCAAATCTCCAGCAACCGCTCAAGTCTATCAAAAACCAAGCTTCCGTAGCAGCACTACAGTACCAACCATGGCC
GCCATCGTCCCGATTTCCTGCAACCAGCGCTGGCGcagtcgctctcgctctcgcaaCGCCAGCACGGACTCGGACTTCCTGGGTCTGATGCCAACGTCAC
CGTCCGTCGCGGGTGAAATCTCCATCGACATGCTGCACGAAGCCACgtccgaagacgacgacgaaaacAAGGGCGTCGAACGGGTCGAGTCTCCACACAA
CCTCGTTATGCCTCGGGAGTACgccgctcaagaagctgcgtggCCGGTTCAACCTATGAACAACGCCAAGTCCATGGAGAGACGACGTGCCAGTGGCTTC
TAAAGCTCAAGTCAATGGATGTCTGTCTACCTATCTACATGTGAACCAACGTGTCGTGAACAATACGAGTCCAAGTCTCAGCTAAATAATCAACTATCTT
GGCCTTCGGGCTGTCATCTAGTCAACTCTTAGCTTGTTTTAAGTCACGTTGAAGGCGGAAATGCTGTCTTTACAGtcttcgagttcaagaacTGCAGTGC
TCGCTCCACAGCCTGCTCGCTACTTTTCTGCGAAGCTTTAGTGCTACCGGTGCAACCCTCAAATGAAGTGATGCACTGCAGGAGTTTGCGTTGGAGTTGC
TCCACGTGGATGGCTTTAGGGCAAAGGAAGGTGTCCATTGTGCTGTAAGATTTAACTGTCTTGCCTGCAGCGACATCGTGCAAGTGTAGGAATTGATGCT
CCACGATACTCAAActcagcagctgcatgcGCTCGAAAACGGGAAGGAGAAAAACGCTGGTAAGCAACGAGCGTCGGTGGTTTGTCCGTGCTTTTCCGTC
AGCCACGAGCTGTTGCAATTGCTCGATGCGAGATCGAAAGGTCTGGAGTGATCGCTGGCAACACGTGATGATCTCCATCATGCACGAAGCCACACTGAGG
CCATCTTGATCGCTCAATGCCAGTAGGCTCCGTTCCATTGATCGCTCCAGGAGGTTCAATGCATTTTTGGTCCTGGGCGTACCCTCCGCTTCAGTGAGCG
CGAGGAAGACACTGCACCGATGTTTCACGGAGTTTGAATGATGGTTTGTCTTGAAATCACCGCGGATTCGACCTGAAATCGTCTCTAATTGATCGTTGAG
TTGTCCGATCAAGTACGCGagactcttcttcttcttgcttaCAGCACTCGCTTCAGTTTCAGAGCTGGTTTTCCCGGACAAAGCTGCTTGGAACTCCGTC
ACTCGAGCCATTTTCTCCACTAGTGTGAATGTGACGCCATCATTACTTTTAATGGCATCGAATCCAACCCGAGTAAAGATTGCGTTCTCGTTAGACTCGT
CCCCGTCGATATCGACATTTTCAAGACTATACGTTGTCCAGAGTGTTCGGAAAGCTGCAAATTCCGATGCACCGCAGTGAGCCGCGCTTAAAGCTCGATG
CAAGCGGTAGAACGGGTGAAACGAGCATGTCGCGACGGCACCGAATGACTGTAGGCGGTGACTGACAGCGGGTGGAAGTGGAAACTCGTCTGCTTTAGTC
GCTGCCTTGGTAGACGACGGTATGGATTGCTCTCTACTGCTTTCACTGATAAGTATGAGTGCTTCGAACAACAGTCGAGTAGCTGACGAGATCTTTGGGG
CTGTTGAACACTCACTTTTACTGTTTGTGAGAAAGCTGGACAAATTTGCTTCGCCGTGACAGAGCTTCGCGCGAAGATTTGGTCCACTTGACATCATAAA
GAGATCCAGCAGAACCGCCAGCGACGCAAAAGGAAGCTGTTCATAAAGAGCATTCGCAACTGACTCGCGTGAACTGTCgctcttctcgtcgctggagctt
ccgGCTTCCAGTAGAACAGCAGGATGCAGCAGTACTTGGTGCTTGTCCTTCTGACCGAAGCCATCCAACGTTGAATAGTACGCGTCTATCTGAGCCAAGC
CGTAGGCACTCGATAACCCTGCACGCTTCTGATTTGCGCGAAGAAACTCAAGTCGCAGTGCATGCTCGAGCACAGGGAGAACAGCAAAAAGAAACCACAG
CTCGTCTCCCCGGTCCACCAGCGCGTTGATAGCACGTCGTAGGAGATTTGATCTCCCTACAGGAATGAAAGAGGCGGTAGTCCACCTACAAACGATTTTT
TCTCGAACTGCCGGTGTTTCTTgtcgaagcgcagcgacaagatcctgctgcagatttccttcttctccttcaagtgTTTGCTTCAATCTTGTCACAAATC
TAGCGTCAAAACTATCGATGCGAAAGAGTTCTGTCTTCTCATCTTTctcagcaccaactccacTCCTTGTAATCCGGTCAAAAAACCTCGACAGCGCCAT
GATGAGTAGCAGCGTAAGGCAGCC