Description :
From Genome Similarity Track
Location :
Scaffold_170:8631- 9842
Sequence
1211 bases(100 bases per row)
agttgaagctgatgctGGTTTCGGTGTGTGTATCTGCTAaactcgtcttcaacttgctgttTCATTCCTCTAATCGTGCAGCGAAACTTCAGGATTCCGG
GAAACGAAgacctgtacatgtacatgcatcTTTTCGATTCAATCCAAAAGGGGAACTAGCCGTGACGACCAGAAGATTGAAAAAGATCACTTGGGATCAG
CCTCTActcaacgccaagaagttgctTCTCGATGCTGACCAAGAGACGACGAATGTATCCTGCGACAACGAAGGCAGCGCTTCGCAGCTGGTGGTTGGAT
ACACGCCGAAAGAAATGGTCGATGCTTTGCTTTTCAGTTTGCAAGAATGGAATGCCGTCCGCTTCTAGAACAAAACGTCCCCCAGCCTGTCGCGCATGTA
GCGCACCTTACCCtctccgcagcagcagacactTGAAGCAACTCGACATCTGGACTTACACAGCGGCCACTTCGACGTTAAGTTAAACGCCAGTCACAGC
GGACAGCAACGGCAAAGCCCAGGAACGAGCTTACACCGGTTTCGCTCAGACTCGTCACGATGGATCCGCCGGCCTTCTCTGCCTCCGAGGATACATCGGA
GGATTCACTGGCGCGCGCCCGTCGCCGgtgagcagcaacaaccgcaTCGGATGAGAGCGCAAGCGATACTGCGCTGATTTTTTTAATATAAAAAtcacaa
gcagcaggctgTTGGCGTCCCAAGGAATCGATAGGTGGCATTGCCACCTATCGTGGGAGCACGCCGGCCCGGCGGCTGGGCGCTAGCAAGCATCATGCCG
TGCATGCCGGAGATGCGATTCGCATCTCAGCGATGGATTTCCTGGTGAAATGAAAAGATTGTTGCCCAAATCTGGGGAGATGTGAAAAAGTGGCACGATT
ACGCGGTCGTTGCACTGCCGGTCTGATGGCACGATGCACGGCATTCGATGCTGTTCCCGGGGCAGTCACAGGCTGTGAATCCAAAGGCTGTGAGTCACAG
CCTTTGGATTCTTGGCTAATGCTGACGGCATCATGATTGAAAGTGGCAAGCAGCAAACCTGGTGGCATTTGCCTTTTGCCTTTTGCCGCAAACAACTTGA
AGAGGATCTGTGAAGTTACTTGCCTTTTGTATGGCACCGCGTTCGGTACGTACCCCAGAGTTCAGAAAGAAGACTGGACTTCAGTATGCGACGCTTAATC
GAGTTTAAAAC