Description :
From Genome Similarity Track
Location :
Scaffold_165:86308- 88511
Transcript NameFunction/comments
Physo_144099hypothetical protein

Sequence
2203 bases(100 bases per row)
AAAAATAATTATGGTTGAAAGTGGAATCACCTTGATTGGTGGTATCTATTAGCTTTTATCTATCTTCTCGCCATCGCTTGCGCCGTGTATTTCATGCCAA
CGACGCCGATCTTCCTCTTGCGTTCTTCAGCGTCGAGACGTCGCTGCTCGAGCTCCTCCGTTCGGTCTTTCCAGTATTGCTGCGAAGCCAAGCCAACACG
TTAGTCATTCACAAGTAGATAGCCGCGATAGCACTACGTCGCACCTCCTTTTGCTTCTCTTTCTGCTTTTCAAGCTTCTCATTCAAGCTCTTGGCGTCAG
CCTCACTCTGCTCTGCTTGGCCAGGAAGACAAAGCTCTTCCAGTGTTTGCACCCAGAGATCCCGGACGCTAGTCGCTCCAGCCGTCAACTCGAGCAGCTT
CTGGCCATTTTGTCCGAGAAGTATCAAGTCAAGGCGACCTGCGGACGTTGAACAAGTGAGTCCCCAAGGCATCATCGAAGCGCTGCTTAGCTGTGCATGT
GTCGTACCCATCGGGCACACTTTGCCAATCCGGTGAATCGGTAGCTCTTCAGAGGCGCTTGGCCCCGGTGTCTGTCGCCACATGAGTCTGTCACCATGCA
ATACGAAATCCGACTTAGTTTTCGCCCCTGTCATGCCCAAATTCTACGATAGCAGGGAACCACACTTTGTAGCTGCAGGGTTTAGCTGCAAGTAGACGCT
CTCAGTGCGGCTCAGCACTCCCAGGAACGCGCTCTTTTTCTTGAAGTCGTTGCCTTCCTTGAGCAGCTCCTGGCGGGCCAGCATCTCCGAGTTGCCACCC
CCGCAGCACACATTGCCCATGGTCGCGACTACGTCCTTTCCGGTGTTGATTCGGAACCAAAAACTCAAAATACCAGTGAACTAGAATACTCTACGCTTTG
ACTATGAAATACATTGATCAGCCTTGGCAAGGGAATGGAGTGAACGACCAACGTGTATATTTCTCATAGCTTCTTGAGGCTTCTTAGAGAAACTGAGCGA
GTACTTGAACGACACGAAGCAGCTTCCATCGCTACCTGGCTTGGAGTTTGCTAGCGTGGCTGTGGAACATATATAAGGAGGCTGCTCCACTTAGCGGCGA
AGCGCCCTGGCCCGGGACGTCTTGGCAGCACAACCACCGCCCGAAGTCGGGGTAGAAGGTGTCGATCCCCAGGGAGAACCCTTCGATGCACCAGCAGCCG
ATGCTCCAGTGGCCGATGCACCGGTGGTCGAGGCCCCAGTTGCAGAGGCGCCAGTGGCCGATGCTCCAGTTTCAGAGGCTCCAGTCTCAGAAGCTCCGGT
TGTCGAGTCTCCAGTGTCAGAGCTTTCCGTGGTGGCACCGCCCTTCGTGGCATCGGCAGCGCCAGTCGACGAGTCACCCGTGTCCGAGCTTTCCGTAGTG
GCACCGCCCTTGGTGGCGTCCGCAGCGCCAGTGGATGAATCGCCGGTGTCAGAGCTCTCGGTGGTGACACCGCCCTTGGTGGCATCGGACGCGCCCTTGG
TCGCGTCATCGGCGCCAGAAGAGGTGCCAGCAGCGGACGAAGTCGAGCTAGCTCCACCCTTCGCAGCGCACGTGGTGGCCTTGCCCGGCGTGGTCGTGAA
GGCCGTCACCGTGAAGTCGGGCTTGCCGCCCTTCTTCCACGTGCAGCACGGGTCGCCAAAGGCGGCACCGTTGGTCATGCTCGAGCCGGGGAACTTCGCC
TCACACAGACTCTTGGACCAGGTGTGACCGGCGGCAGCAAACGCTTGGGCGAAGTCCGTCGTCTTGGAGCTGTCGCTGCCAGGGTGTCCAAGCGGCTGCT
GGAACGAGCTGCCGTTCGGAAGCTCGTTGAGGTACTTGGCAAGGCCGTGGGCCGAGTCCATCGTGGACGCGATCGTCAGGGCAGCGGCGGCGACGGCAAG
TTGGATCTGCATCTTGGCTGTGTGGGGAGGTCGGTCTTTCTGGCGATGCGGATGTCGAGGCAAATTGTAAAGTGAGAAGTGGAGTGAGGACGCTCGGTCG
AATGGAGTGCTGGGGCAAATATTTTACGGATAAAAGTGATTCACAGGCAAAGTTTCTAATGGCGAGGAAAATGTACAAGCGTTCTGGAGGTGCAGGCGTC
CGCTTCGGCGGATGGTGAAGCGTATCCATGTATGCTTGACGCAGACAGCAAAACGGTGAGTCGGGCGCTTCTGCACATCACGGTGGCGATCTTGAACATT
TCA