Description :
From Genome Similarity Track
Location :
Scaffold_360:863- 5845
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_360-snap-gene-0.11Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family

Sequence
4982 bases(100 bases per row)
TATGTGTCCGTCAGTGTTGTTGCTGGGGCCACTCGACGAATCCGCCACCGGTTCATTCTCGCATTCAACCAGTTCTTTGGTTTTTCCAGCCATTTTTTAC
TCTGTTTTTGGAATGAAATTACTCCGCTTTTTTGTTTTGGATGTGATCTCGACGTTGCTGCCGATTGTGGATGCATTCATGGATGTACAGTACAGTATGG
ATTCATGCATTCATGGATCACCGATATCGTGGGTTCGGTCCTACGTTGTACGAGAATATGTATGTTCGTGGTCGTTGCGTCTGATCTCCACATCGCTCAC
GTTCTGGCGAGTCTGGCGGGTTGTGCCCCACCTCCACGACTGGGTCGTATCAATTTTGTCGTGAGAAGTTGGAGTTGTCCGAGAGTCTCGGGCCGCTTTG
CGAGCTCCCGTTCTGTGCCGTAATGAGGGCACAGGCCGGTTGCGCCGCAAAGTGACATGCCGGTCGTCGATGCACACAAGCTCTGCTCCGTGATGAGGGA
GCAACTCGCTTGGTGTGGCTCGATCTCTGGCACTGGCACTGGCAGTCCAGTGTGTTGACCTACACGCCGTGATGAGGGCGTGTCCGGATGGATCTCCGCA
GTCGCGCGTAGCATCTGCCAGCAGCTCGCGACCCCGTGATGAGGGAGCCGCGCTCGCTGGCTGGCTGGTGCACACGCTTCCGTGGTGTTCCGTGGACGGA
CTTGCACTTGGACGGAGACTGAGACTGAGACCGAGACTCGTATTGTTGATCTCGGACGACTCGACGTTGTGGTGAAACGGCACGTTAGTGAGGGCCAGGC
CGTCGCCCTGGGCCTGGGCCTGGGCCTGGGCCTCTGCGAGTTTGAGTTCGATTTCGTGGTTGAGTTTGAGGTCGAGTTTGATGGCCTCGGCCTTGGCCAG
GGCCTGTGCGAGTTTGAGTTCGATTTCGAGGTTGAGTTCGAGGTCGCTTTTGAGTTCGAGCTTGCGGTCTTGCACATACTGTTCATGTGGTTCGTCCCAT
TCTTCTGTGTCGTCCGTGGAGTCGTCTACAAAATGAACACGGCGTTGGATAGGGATATCGACGGTGCTTTCTGGGGTGTGTGGAAGTTGGGATGGAGAAC
CGCGTGGAAATCGACGCGATCGACGGGAGGAACGACAGACGAAATGATATGCAGCTCTTGAGGCGGACACTTCGTCCTCTTGGACGGCTTCGTCTTTGTC
TGATGAATATCCCACATGGGAAAGTTGGCGCAGACGAAGAGCGAGTGTGCGGCTAGGTCGACGGCCGGTGACATTGCGCCATGAACGCTTGTCGAAGTTG
ATCGTTATGACTTCATCATCGACGACGGTTGTCGTTAGGTTTTGCTGCGGAAGCTCGTGTTCAACTTGGTCATCAACTGCTGGCCGGGTGTCCATGGCGT
GAGTCGCTGGAGAAAGAGCGCACATATGTGTGGGCGTATCGTAGGTATCATCGGTATCATGCGCATCATACGGTTCTTCCTGCCGCCCTTCTCCTTGAGT
GGAGGAGCGCGGCGAGAGGCCAAGTACGGCGGCAAGTGGCTGCTGTTCGATGTCCGCTTCATAACCGTGATTGCTATTCTGATCATCACAGCAGCTCGCG
TCTGAAGTGTCGGTGGTCCACGCGTATGCATCGGCCGAATCAGCGGCGGAACCGTCGTTGTCGTCGCAATCTTCACCATCGGTCTCATCATATCCGCTAT
CATGCGCGAaAGGTTGGCTCTCGTAATCGTGTTCATCTTCCTCCACTAGTAACGATACGTCAATGAGGCTGAAACCTGAGGAGGAGGATGATGGTGCTGC
TCCTGCTCCTGCTAATGATGATGATGATGGTGCCTTCGACGTTTCTTCCTCCTCCACACTTGACGGGGTGTCAATGAAGATGAACTCCGAGGCGGAGGAC
AACGGTTCTTTCTCCTCTCCAAGTGACGAGGCATCAATATCAACGGCCATcAACTCTGATAATGAGAGCAACGGCGCTTCTTCCTCGACGTGGTCTTCCA
ATGCTTGGCGATTGAGAGAAGTCGGTATATCGGCCAGACAGGGATCAGCACAGTCATGATGGACGCGGTTAGAGTTCACATCGGGACGCTGGCTGAAGAT
GACGCTGGCCAGGGCGTGTCTGTGCTCGTTGATCGTGGTGTCGCAGTCATCGTGGTTGGTGAGCATCGCCTGCTCAGCATCAAGACCATGATCAGGCTCC
AGCATCAGCTCATGGTCATAGTCAGGCTCCAGGTCTGGTTCCATGGCGTAGATCTGGTCATGCTCGTCTCGGCCATCCAGTTGTTGAGTGGGCTGTTGTT
GTGTTGGTACATGATCAAGTGGAATGCTCTCGGCGTGGTTCGTGTGGCTTGTGTGGCTCGTTTTCGGAAGCTGGTTGTAGATGAAATTGACCAGATTGAG
TCTGTGCTGGTTGATTTTGTGGTCGAACTCGCGGTCTTGTTTGAGAGTGTCGAGCTCTGCCTGTAGGCGGTCAATGTGTTGGGCCATGACCTTCTTCTCT
TCTTTGGCCTTTTGCACGTAGTGGACCGCCGCGAGTAGTTCCTCACGAAGCAGCGACACCTGAATGCGCCAGAGGTCTTGTGTGTAGGCGCACTGGTGGA
GTATAGCTCTCAGGAGCTGGTCGGGCTGATTGTGCGCCATGCGCTGGTGCGCGAGTGGCGTTGTTGACGTCGCTGTCTTTGGCATTGCAGGTGACGTCAT
TGGCGCGGCTGAGCGCGCATGCTGAACGTGGCCAATGGCAGCTACAATGCGCTTGAACGCGACGACGCGGTCCATGTTGAAGCGGTGGAGCGTGGCGTGC
ATGTCAGCGGCGAGGGATCCTGGCGAGGAAAGGAAGCGGTCTGCACGGTCGACGTGCGTGGCGTGCGTGTTGTCCATGGTGTTGTTGGCGGCGTCCAGGG
CGGTGATGGGTGATGCTGCCTGCGGATGCTGCTTGTCGAGGGCTGGAAGCGATCGTTCTCTCGGTCTGTGGGTGTCTTGGATGTTTTGCTCATGTTGATG
GGGAGTCAGGGGGGTGGAAGATGTTGGTCTTGGTATGTGCGTGTTCGTGGTTAGTTGTAGCCAATGGGCGTGTGGAAGCGTTGGTGTTTGGGCCAATGGT
AGCGTGGTGTGGGGCGCTGGCAACGGCGGAAAATCTGGTTCGAATGAGATAAGATCCAGATATTTTAGAAAGTATCCAGCTCAGCAGGGCTAGGGCTCTC
TGTGGTCGCTTCGCCTCAAACCAAGACTACTAGACCAAGACCAAGAGGGAGGCAAGTGGCACTCTGGTCCCTGCGTACTGTGATCCTGTAATACAGGGAT
CCTGGGATTCAGCATACCAGCCATATCTCGGATCGAGGGGAACACGGTAGTCAACATCCTCACTCTTGAACTCACTTGACCTCTCATGTGACGCGCGGCG
CAGAGCGGTGGACTACGAAGGACGGCACCAAGACAACGAGTCAAGTAGAAGACGCAACGAAGAGACAGAGAGACGGAGAGACGACGGGCATCAGACGGCG
GGACCGACGCCAGTGCCCACGGCCGACAGCCCACAACCGGCAACCGGTAACAGTACTGCTATAACTATGTACGTCAAAAGCTATCGAGAGTAGCGCAAGC
GCACAAACCACGTCAACACGAATAGAGCAAGTTGATGAGGTTCATTCCGACTGCATGGCGAATGACGTTCTGATCTTTCCTTAGTGTTCAAGTCCAGATG
GACAGGATGCCCATGGAGAagAAGCCGAACAGAAGCGCTGAGCACTTTGTGAAGAGATACCTCTGGTTTTGAAGCTCCTGGGGAATAGTCTCCaTAACGG
CGACAAAGaGGAACGTCCCTCCTGCCATCGCGGAACaGATCCCGCTGGCTGCCGTCTCCTGGGAACTATCGACCATAAGCCAGCCCAGGAAAATGCCGAG
TGGTGACATGGCTGAAAAAATTGCAATCGTTGAGATGAGGCGTTTCCGTGGTACGTTGTGGTGCATAAGCTCGAGGGCCAACGCAAAAGCAGCCAGCGCC
TTGTGGGCGAGAATCGCGATGAGGATGTCCCATGCAGCACCGTTCGAAGCGCCAACACCCATACCTTCCATGACTGAGTGGAAAGACAATGCGGCAAACA
CGATGAACGCGAGGGCTGGATTTGCGTCCATGATTCCGTGGATATGGGCATGAGTAACTTCCATGTCCACGCAGACATCTCCATCAGCCGGTAGACCATT
CACTGGATCGCGCAGTCCACTTAATCCATACCGAACCTCTTGATGGGTCGGTGGAATTGAGTCGTGGGTGTGATTCGTCGCGTATCCATTGTGGGAGTGA
CCAGTTCCGTTCACATGAGATGCGCGAGGCTTGTCCAATATCACTGCTTCATCCAGGCTTGGTTTTACTTGTGAGTTACTCACTGTGTTCAGTATAAGTG
GAGTGTGCTCGTTCACGTTGTCAGTCTTCTCACCGAACCTCCGCTGAATAGCGTGCGCAAACACTTCCAGCATCATGACCATGAGGAAGCCAACGGCGTA
GAAGAAATATGCCAACTGAAGACACTTGCCCTCACCAAAGCACCCAGCTGCAGCGAGAGCCTGATTTTGTTGCGCATCTGGTAGCAAGTGAAGGCACGAA
CCGGCGAGGAAGATTCCACCCGCAAACATGTTGAGTATGCTCGTGACGACGAGGCTGACACGGTCTTTGATTAGCAGCGGCGCAAAGCCGCCGATGATGG
CTTGCAGCCAGATCACGCCGCCCGATACGAGCTTGAAGGTGTTCACGTAGTCCATTGCGTGCGCACAGCGGTGGCTTGCGAGGCGTCGGGGATATTGGGA
TCTGCCGCCCGGTCCATCGCCAGTTCTTCGGCGTGCGTACTTCTTCTCCGACGGCGGAGACGTCTCGTCGCACAGATGGAGTCTTAGAATATGGACTAAT
CGGGTGAATCCATAGATAGGCGCACTAAATGTGGAATTTATGGAGTACGAGAAGACATGCCGCTATTGGCAACATGGGCAAT