Description :
From Genome Similarity Track
Location :
scaffold_1222:863- 2736
Sequence
1873 bases(100 bases per row)
GCGATCTTCGTACCCTTCATCGTGATAGTCACGGCCACCGTGGCGATCCATCTCGTCATAATACGTGCGTCGCCTGCCGTCGAAGTCTTTGGGACCGGAC
TTCTTAGCGTACGAATCATCCCAGCCATTGTCACGTCTTCCCCCGTCCCAATGTCCATCCGATCGTGGCCGCGATCTCGATCTTGATCGTCGCCGATACT
GCTGCTCCTGCGGACGACCATGGTAGCTCTCTTGTCGCTGGTAAGATCGCTCGTTATTGGATTGCTGTCGATTTCCTGCTTTGCTACGGGCTGGCCCCGG
GATAAATACAGCGCTGCTCTCAATTTCACCTTCTTCTTGTTCTTCACCGCTTTCAACCTCCTGTTCCGTGAGACCGTTGTCTTGTGTTATTGCACACGTA
GATACTAACGAGGGCGCCAGAGGTCTTGATTCCGTCTGCGCATTTTCTCTTGTGTTTTTATCACCTCCATTCGTGCTGCTCGAGCCTTGATGTTCTGCTG
ACGATAATGCTGCGCTGGATCCAGTCACTACAGCTTCATTTCTGCCCCCACCGCCGCTTCTGTTTGCCACTGCGCCAAGCTGCTGGCCAGGAAATTGTTC
GGGCCTGGAGTGAGACCTACTTCGAGATCTTGATCGATACTCCCTGCTATATCGACCGTACCCGTCCTCTCGTTGAGCAGAAGGTGGTCGATCATATCTC
GAGTACCGATGCACATTCCGATGCCTATCTCGTTGCGTGCTATCACCTTGTGATGATTGTGATTGAGGCTCCGCCGGGCTCCGCTCACTTGAGCAGGATC
GCCTTGCTGTAAGCCGGCTGCCGACTCCATTCGAAGGAGATGACCTTGGACTGCTTGAAACGCGTTGCTTGTGCTCGCGTTTAAGCTCCAAAGGGTTTTC
AGCATCGTCACGGAACAAATACGATGCTCTCTCGGCGTCCTCAAGGTTGTTGTAATGCAAATACACAGCGCCCCCTTGAGCTTTCGTGATTCTTTGCCAA
TTTTCTCGCGGGATCTCGCAGCGTGGCTCTGACTTCTTGAACGTGTAACGTTTGCCTAATGCTGCTGCAAATTCTTCCCGGTCGCGGTCCTGGTTGAACC
GTATGCCTGTAGACTTCCGCTCAAAGCGTGCAGTTCTCATGATTAGTGTTGCTCGTCCGCGCAGATGCTGCGGTACAAACGTCGCGCCATACATCCGTCG
CTGGTAAAATTCTCTATCCTCCGGCCGTCCAAAGCGAAGTATCTCATAACAGCTCAATGTTCGATTCTCCGTATCGCCATGCTCACCAGCCCTTAGGCTA
GAGGTTCCTTTAGCTTTCGGGACCGCAAGTGAGAGGCCAAAAAACGAGTTGGCAAACGAATGTTTGTCCTCAGCCATCTCGTGCTTCGTGGCACAGTCCA
GACGTGAAGCCAAATCAGGGAACACTTTACCATCGCCATCACGAACTTCATACCCTATCATCTTGCCATTCGCTAGCGATGGCCGGGCTGCCAGTTCTGC
TGCCGCCAAGAAGATCGAGTTACGCCTTCGTGCCATCCGCATAAGCGCTTGATCCTGCGTTGACACGGCGAAACATTTGACGGGTACCGGATTTTTTGTC
CTCCTTCGCTGCAAGCGAATTGGCTCGCGGTCGGAAAGCTGCGGACTTGACGCAGGGGGCAACACCGTAGTAGGGCTATAAGTGCCAACAGCACCACGAG
GACCAGCGAGAGTGCCATCTCGAGCTTCAACCTTCTCTTCAGTGCTTTTGACAGACTTCTTCGGGATCATGAACGCCGCAGCTGTAGTATCTCTGGTAGC
TTTTCTTGGAATCGGTGTCATATCCAGCAGCACGTCTCTCTTCTCGGCACTGATTGCCTTTTCATCTATATCT