Description :
From Genome Similarity Track
Location :
Scaffold_970:863- 1885
Transcript NameFunction/comments
g9944.t1hypothetical protein

Sequence
1022 bases(100 bases per row)
ACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATCGCACTGAAGAGCGCAGGACAGACCGGGAGCAACACGCGGA
CCGCCGGGTTCAGTTTACGCAGGAGGAGCGTGCTGAAGCGCAAAGGGTAAACCAAGAGCAACACGTGGAGCGCCGGTCTCAGCTCACGCAGGAGGAGCGC
GCTGAAGAACGCATGGTAAACCAAGAGCAACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAAC
ATGCCCAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCCGAAGATCGCATGATAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGA
GCAGCGTGCTGAAGAACGGATGGCAAACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAA
GAACAACATGCGGAACGCCGCAGAGAACAGACCGAGGAAGAAGCACTTGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGG
CGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTG
TGGCGCTTGGAAGTGGCCTGGCGAATCAAAAATGAGCTGCTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGTCTGCACCTCCAAGATTGTTGCAA
CTGTACCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGG
ACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATAT
TGATCCCGCCACCGGAGAGCGC