Description :
From Genome Similarity Track
Location :
Scaffold_15:86281- 88164
Sequence
1883 bases(100 bases per row)
GGGGCCGGATCAATCACTCGTCCAGATGCACGAAGCTGGCGGTAATGGATAATCCTTGCATTGAGATGCCCCAGTCGATGAGTGCCTTGTAGTGCTTTGA
GAACAGCGCTGGTTCCCTTCGATTGCACGTTGTTGCTGCGCAGAAATTCCAGCGTAGCGATCTCTGCGGCAGCTCCTGTGGACAGCACGTCGTCGCGGAA
CGTTTGGCTGTCTTCGTCCAGCACAAACCCGTCGGGTAAGAACAACTTCATGCAGGCTACGATGTGCTTCGACGTGTACTTCTTCTGCTTCGATGCGCTG
CCATTGTAGACCATTGGTTCGAGTGTGAACCACTCATACCACGTGGACCGCAAGGAAGCAACTGAACATTGCTTTTGCCGTTTCCCTTTGCTGTTCGGCA
TGACTTGCCCGACTTTGACCTCACTTTCCTTGCGCTTAGGTGTGGCACAAGTTTGAAGCTTTTCCTCAAGGGCTTGGAGGCGCTTCTCTTGTCGCCGTCC
GATGTTGATGAAGTGGTCAATGACTGATGCCTGGTGTCGAATGAGTCTTTGTTCTGCGGTCTCGTATGATGGTGGGGAGTCGTTCGACAATTCACGAGTT
GATGCTGACGGAACGGCTGCTACGCTGATAGGCGTGCTCAAATGGGACGACCATGCTAACAAGTCGACGTTGCTGCATCCTGCTAGACCAGCGCATTCCT
CGAGGCGCATGATGGCAGGGCTAGAAGGGCTCAGCTGCTTGAGACTCGGATAGTGCAAAAGGAGGTACGTTGTCAACGTGTCAACAACACGCTTGTTAAG
ATTGAACGATGGATTACCAAGCCCAGTACATGTTGCAAATAGATGGTCCTGGACAGCGTGGATGCTTTCGGTCGTCTGCGAATCGAACGAGGTAAGATCC
AAAAGCACAACTGGTTCTTTTGGAGACCACCCGCTCAACACTTTGGCTACTTTGTGGTCTTCACTTGAGGTGATGAAAATGTAGTTGAAGCCCTTGTTGG
TTGCGGAGATGTTCCACGCCCTGCGGTCGAAGATCCAACGCGCCGTTAAGTGCTGTGATCCGTTCGCGTGTTGCGCTCCACCACGACGAAACGAGTGAGA
TGTCAACTTGACGTCGACGCCTGAAGCGTCACCAATGCGACCAAGGGAACGATTCACGTGACTGTGAATGGTAGGGTCGCGAGGCCTTGTTGCAGCCGAG
GCCTTCACGTTCCTTGGGACTTCAATGCGGCCGGGATTGTCCAGGACGTCAATTAGCGGCGTTTCAGGGCCAAGGATGTGAGCCACGTCAGTACTCTGCT
CGGGTAGGTTGTTCGCGATTCGAGAGCATGGCGCTTGTTGTTTTATCATTGCAAGCGCCGTGGAAAGCAAAGGGCAGGTAGTAAAGTTTGAGTCAGGGTA
AATCGATAGTCCTTGCTCTTCACTTGTCTTTACTCTCACAAATCGTAGGAAAAAAACACCACCGCCGTCGATAGACAAGTTGTGCTTTCGAACCATGGCC
AAATCGGACGCCCGCCCAAGCAGATACCAAAGCAACGTCAACAACGCAGCGTCCTGGTAGTCGCAGCGTTCGCATACAGATAGCGTATCATTAATTGTAA
TGAAATCTTCGTGCATGCAATCGATTGCTTGATGATCGCGCCGCCATCTTTTTTCGCACAGTAGTTCTGCAAGATCTTTCCCGCACACAACAACTTGGAT
TCCACCAGAGCCTGCAGTCGAGGAAACTGGTCGAGTAGAGACATCTTGGCCTGGCGGAAGTACTGCATGCACGAGTTCTTTGCAAGCGGAACGCCAGGTG
CTCTTTCACATGCAGCAAGGTACAGCGCGAACTTCTCCATTACGGATGCAAAGCACTGACCAGTGGTGTCCTTGCGCATGCAC