Description :
From Genome Similarity Track
Location :
Scaffold_423:8627- 10239
Sequence
1612 bases(100 bases per row)
CCTCTGAAGTTAACTTTGGAGATCAATCAGTTCCCTCTGGTGAACCAAAAGAGAATCTTGCGTGATATGCGTAGTGGCAAAGTCAAGCACATCTGCGTAC
TCGTCGCGGAAGATGAGTACTTTTAGGTGATATCCGATCGGCAATGGTCTTTACCGAGGGTGAAAGGGTTCTCTGTAGCTCATCAATGGACGAGAGTGTC
CTTGATGAGAAGACATGGAATAAGTCAATCGTTGGAATCGTTCAAAGCAAATCTTCTCTTCGATGATTTGATGAAATTCAGGAATGTATTCCCAGAAGCA
ATCCCATGCGAATTAACTAAGGACAAAGGTACTCGTCACGAAATCGAACTGAAACCGGGTTCAAAGTACTGTGTCATGAAGCAATAGCCACTGCCTCGTG
AACAAGTACTAGCGATCGACAAATTCTTTGCAGATCGCTTAGCAGCCGGCAATGTGAGGGAGTCAACATCGACACATATCTCTCCGACCTTCTGTTTGCG
AAAAGCCACATGAGGGTGGCAGATAGTACATGCCTTTAACAAGTTGAATGCTGCTACTGTACCGGCTCAAACACCAATACCAAGGAAAGATGTCATCATA
GATGGTATGGCAAAAGTACCATATTTTCATCCATGGATCTGATGGATGGGTTCTATTAAACCCTTATGCGCGAGAGGGGCATTCCCTATACTGAAGTGAG
CACCCCAAGCGGTATACTTTGGGAGTGGTCAGTCATGCCTTAAGGGCTAAGTAATGCTTTATCGAATTTAAAAGATGTGTGAAGAATCTGTTAAGATCCA
TAAGGTAGTTTGTGCCCATCTATCTCGTGAAGTGTTTGTCCATAGCCGGGCTATAAAGGAATAGACGGATGTGGAAGTGCACCGACTCCTCGTTCGGAAG
ATTCTTACAATTATGCGCGTGCATAATTTATGCCAACCTCAAGAAGTGTATATTTGATGCTGACAAAACACCACTTCTTGGTTGCATCGTGGGTAAGCAT
GGCGTCCGGCCCGATCCGAAAAAGATCAAGGCAATCACAAACTGGCCGGTGAGTACAGATGTCATGAGGCTTCGGAAGTTCCTTGGTCTAGCGTCGTGTT
TGCACAAATATTCACGCAATTACGCCGAGATGACTGTCCATCTCTCTCGTTTAGTAAAAAGAACGAGAAGTGGATATTAAGTGCCGATTGTCAGCGCTCT
TTCGAAGGTATCGAGCAAAGCTTAATACAATCGCCAGTTACAGCGATTTCAGACCAAGACAGGCCAGTCCACATAGTCTGTGACGCCAGTGACTTTGCAA
TCGGCTTTGCGTTGGTGCAGTACGATGCAGACGATGCGGAACGTGTCGTCTGTTATCAATCAAACCAGCTGAAACCAGCAAAACGCAACTACCCCGTCGA
TGACAAGGAACTCCTTTCCATGAAGTACACGCTGGATAAATTCATCGTTTATCTGCTAGGCTATAGATCCTTTATCGTCTATACGGACCATGCATCTTTA
CGAAGGACCGTAAACATTTCACACCTCTCGCAGCGGATGGCGAGGTGGCTGTCATTCTTTGCGGAGTACACTTCCCCGTCGAGTGTAAGCCAGGACGACT
TAACGTCGTCGC