Description :
From Genome Similarity Track
Location :
Scaffold_264:86225- 87367
Sequence
1142 bases(100 bases per row)
TGTGTCTGCACAGCACGTCACGAAAATTTTGTCCCCCCATTTGGGCGGTTTGTCTTTCATGAACTGACGGGGGACGTTGTGGCGACTTCTGGATGGGATC
ATCGCCTCGTCGAAGGACAACACTGGGGGCACCGTGTAGCCTTTCGCGAAAGTAAAGTACGACGTATCCACGACAGACCTGATTTTCCACGCGCTCTGTC
TCCGCACGCGGGTCTGTGCTGTTGGTGAAATGTAGATTCTGTATGATGTTATCGAAACGTGCTTTTCGCACGAAAGATTTAAAAGTGCCCTTAGGCACAG
CGCCCACTGCATTAGTCGCCTAATGGTCTGCGAAACGTCGCTTGCGAGGGCATAGTATTCTTGCCACTAATAGCCCAATACAGTGCAGCATGTTTTCTGC
TTGAATCTTATTGTGGCTCTTTGTTTCTCTCAGCAGTACGTCTTCTCTCGTTCCCTCTTCTTGTCGCGCCTGCCGAGACGCATACATGCACTCCTGCATT
TAAGTTCTGTTCGTAGTAGCGGTTGCTCTCCATTGCAATACGCCTCCACAATCGCGGGGGCATAGAGTAGAAGAGGCGGAGAGGCAATTCCGCCAGCTCA
AACACTTCTTATGTCGATTCATAAGCTCGAAATACAGGCCAGGATACGCCTCTGCTCGGTCCAGATGCGGTGTTGCATCTAGGTGCATAATACAGCATGT
TCCATGAGCTGATGTCATTTATAATACATCCCCAAAACAGATAAACGTACCGAAGTTCCACCTGTCGATGCTCATCTTCTTCAATGCTTCTTATCTGACG
CCAGCAACTCCATCTCTTTCGGTGCCATCGTATCCCAGTGCTGGATTGTAGTTGCCCAGTCGCATTTGCCTTAGCGGCTTCAAATCGTTCGCGTTTAAGC
TGTCGCTTGGTTCGATTCTTTGCACGAACTAAGAGAGTAGCACCATCCAAGTCATCGTCGTCAGAAAGTTCGTCCTGCTCGGGCGTATAGTCGGCAAGGT
CTAACGTCTGCACAGTATCATCATCGCCGTCGGTAGGTGCAGTGTTGTCGTCCGTCTCCGGGTTCCAATCATCCGAGTTGATGTCATCGTCCACGTCGGA
ATTAAACGCATCACAGTCCGTAGTCCGGGATTCTACAACCGC