Description :
From Genome Similarity Track
Location :
Scaffold_1030:8620- 10048
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1030-snap-gene-0.5Phospholipid-transporting ATPase

Sequence
1428 bases(100 bases per row)
AACGCGGCACAGGGCTACTGCAATAACACGGTAGTCACGTCGCGCTTCACGGTCTACAACTTTCTCCCCAAGCTGCTCTTCTACGAGTTCAGCAAGCTCG
CGAACGCCTACTTCCTCGTGATCTCGGTCATGCAGACCGTCAAGCCGATCTCCAACACGGGGGGCTTCCCGGCGTCGCTACCAGCGCTCACGATTATCGT
GCTCATCGACATGTTCTTCGCGTGCCTCGAGGACTACAAGCGCCACAAGGCCGACCACATCGCGAACGAGCTCCCGTGCCGCAAGTTTTCGCTCGAGGCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCACTTGCATGTGGGCGACGTCGTCAAGCTCTACAACCGCGAGGCCGT
ACCGGCTGATCTCGTGATCCTCGGCGCCTCCGAGCCCGATCCGGAAAACCCCGCGGGCATCTGCTACGTCGAGACCAAGAGTCTGGACGGCGAGACGAAC
CTGAAGCTCCGCCAGGGCCTTGAGGCGACGTACACGATGCTGCAGCGCGACGAGCAGATCGCCGACCTCGCGGGCGTCGTCATCTGCGAGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCTCGTCGTCAACACGGGCCCAGACACGAAGATCATGATGGCGTCCTCGAACACGCCCATGAA
GTGGAGCAACATGGAGCGGCGCCTGAACCGGCAGATCATGTACATTTGCGCGCTCATGGTCGTGCTCTGTCTCACGGGTGCGACCGCGTCGGCGATCTGG
AACCACTCCAACCTGAGCAGAGATCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTACCTGTTCGACAAGAACACGACG
GCAGTGCGCGCGCCCGTGGGTAACTTTGTGATCCAGGTGCTGTACTACTTCCTGTTGCTCAACTCGTTCATCCCCGTGTCGCTCTACGTTAGCATGACGT
CGGTCAAGTTCATGCAGGCGTACTTTATGAACAACGACCTCGAGATGTACCACGAGGAGTCGGACACGCCGTTCCAGGTACGCACGATGTCGCTGAATGA
GGAGCTCGGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN